ARCHIVÉ - Émergence de Shigella Dysenteriae de type 1 résistante aux Quinolones au Canada

 

Volume 31-19
le 1er octobre 2005

Introduction

Shigella dysenteriae de type 1 est un pathogène humain endémique responsable de flambées de dysenterie bacillaire aiguë dans les régions à forte densité démographique; des clones récents sont résistants à une large gamme d'antimicrobiens(1). Au cours des 2 dernières années, une résistance aux antibiotiques de type quinolone a été signalée en Inde et au Bangladesh(2,3), probablement dans le cadre de la tendance établie de cet organisme à acquérir rapidement une résistance aux médicaments actuels. En outre, ce profil de résistance ne laisse que peu de solutions thérapeutiques fiables et économiques dans le cas de S. dysenteriae de type 1. La shigellose et la dysenterie, notamment la maladie à S. dysenteriae de type 1(4), sont des maladies relativement rares au Canada et aux é.-U. Entre 1998 et novembre 2004, parmi les 110 cas de S. dysenterie signalés au Laboratoire national de microbiologie (LNM), seuls trois isolats étaient de type 1. L'un d'eux était un isolat résistant aux quinolones (numéro de lot du LNM : 04-3516) que le Laboratoire de santé provincial de l'Alberta a prélevé, en juin 2004, chez un homme de 56 ans de Calgary (Alberta). Au début, les épreuves de sensibilité aux antibiotiques ont révélé que l'isolat 04-3516 était multirésistant aux médicaments, y compris aux quinolones (ciprofloxacine et acide nalidixique); cet isolat a été associé à un voyage en Inde. Une souche de S. dysenteriae de type 1 (isolat 04-3515), isolée en même temps chez un homme de 31 ans d'Edmonton, en Alberta, qui n'avait pas voyagé récemment, présentait un profil de résistance aux antibiotiques semblable, sauf qu'elle était sensible aux quinolones. Nous avons tenté de déterminer les mécanismes de la résistance aux quinolones encodée par l'isolat 04-3516, et le degré de parenté génétique de ces isolats canadiens de S. dysenteriae de type 1 avec ceux observés en Asie méridionale.

Méthodes

Les épreuves de sensibilité aux antibiotiques ont été effectuées selon les directives du Clinical and Laboratory Standards Institute relativement à la méthode de diffusion en gélose, et les valeurs de concentration minimale inhibitrice (CMI) ont été déterminées par microdilution en milieu liquide (Sensititre, Trek Diagnostics Systems). Les oligonucléotides utilisés pour la réaction en chaîne de la polymérase et le séquençage des régions responsables de la résistance aux quinolones (RRRQ) des locus gyrA, gyrB, parC ou parE ont été décrits précédemment (voir plus loin) ou conçus après comparaison entre les amorces des RRRQ de E. coli(5) et les séquences de S. dysenteriae M131649 (NC_004510) : parC (STPARC1(6); TDCPARC2-R: 5' GCTCGGAATATTTCGACAACC), parE (GIL223: 5' CACCGAACTGTTTCTTGTGG; GIL224: 5' TGGCAATGTGCAGACCATCGG), gyrB (GIL225: 5' CAAACTGGCAGACTGCCAGGAG; GIL226: 5' CAGTTTGTCCGGGTTGTACTCG), et gyrA (STGYRA1 et STGYRA12 [6]). Nous avons utilisé le programme ClustalW (http://www.ebi.ac.uk/clustalw/index.html) pour comparer les séquences aux locus gyrA, gyrB, parC ou parE encodées par S. dysenteriae M131649, 04-3515 et 04-3516, dans le but de déceler les mutations encodant la résistance aux quinolones. Nous avons utilisé l'électrophorèse en champ pulsé conformément aux protocoles normalisés de PulseNet.

Résultats

Pour déterminer le ou les mécanismes de la résistance à la ciprofloxacine encodée par la souche 04-3516, nous avons amplifié et séquencé les RRRQ des locus gyrA, gyrB, parC et parE et les avons comparées aux mêmes RRRQ encodées par la souche 04-3515 sensible aux quinolones. Par comparaison à la souche S. dysenteriae M131649, la souche 04-3515 sensible aux quinolones présentait des séquences de RRRQ de type sauvage aux quatre locus examinés, mais l'isolat 04-3516 présentait des mutations ponctuelles encodant des changements de codons aux locus gyrA et parC (tableau 1). Le gène gyrA de l'isolat 04-3516 résistant aux quinolones encode des substitutions Ser83Ile et Asp87Asn. La résistance aux quinolones de la souche 04-3516 s'accompagne probablement aussi d'une substitution Ser80Ile encodée par le gène parC.

Nous avons obtenu une empreinte génétique de l'isolat sensible aux quinolones et de l'isolat résistant aux quinolones par électrophorèse en champ pulsé (ECP) après digestion de l'ADN chromosomique par Xbal ou Blnl (figure 1). Le profil de bandes Xbal de l'isolat 04-3515 était corrélé au profil d'ECP de type A3 des isolats provenant de flambées sporadiques observées au Bangladesh et en Inde par Talukder et ses collègues(7). De plus, l'isolat 04-3516 n'était pas représenté dans cet ensemble de données d'isolats de S. dysenteriae de type 1 de l'Asie méridionale, mais 12 des 13 fragments d'ADN correspondaient aux fragments des isolats 04-3515 et de type A3. Une analyse de la teneur en plasmides a révélé des profils identiques pour les deux souches, notamment des plasmides de bas poids moléculaire de 2, 4 et 6,3 MDa (données non présentées).

Discussion

Les déterminants de la résistance encodés par S. dysenteriae de type 1, comme ceux d'autres pathogènes entériques, sont présents sous forme d'intégrons et de plasmides conjugatifs, ou la résistance est conférée par des mutations ponctuelles au sein de gènes encodés dans le chromosome. L'un des mécanismes de la résistance aux quinolones repose sur la modification de la cible des médicaments – celle de l'ADN gyrase et celle de l'ADN topoisomérase IV – qui sont deux topoisomérases de type II. Des mutations au niveau des locus gyrA et gyrB (ADN gyrase) et parC et parE (topoisomérase IV) ont été signalées chez Escherichia coli et Salmonella spp. résistantes à la ciprofloxacine(8,9). Une analyse de la séquence des RRRQ aux locus gyrA, gyrB, parC et parE a récemment été effectuée chez des isolats de S. dysenteriae de type 1 résistants à la ciprofloxacine(7,10), et nous avons décelé des mutations identiques aux locus gyrA et parC encodées par l'isolat 04-3516 résistant aux quinolones. Ces similitudes génétiques et le voyage en Inde associé à cet isolat indiquent que la transmission de la maladie au Canada provient de cette région.

Figure 1. électrophorèse en champ pulsé de l'ADN génomique digéré par Xbal et Binl de Shigella dysenteriae de type 1 sensible (« S », isolat 04-3515) et résistante (« R », 04-3516). Salmonella braenderup H9812 (digérée par Xbal) est également utilisée dans les premier et dernier couloir comme étalon d'éCP à des fins de comparaison interlaboratoire

Figure 1. électrophorèse en champ pulsé de l'ADN génomique digéré par Xbal et Binl de Shigella dysenteriae de type 1 sensible (« S », isolat 04-3515) et résistante (« R », 04-3516). Salmonella braenderup H9812 (digérée par Xbal) est également utilisée dans les premier et dernier couloir comme étalon d'éCP à des fins de comparaison interlaboratoire

Les profils de bandes Xbal d'ECP des isolats 04-3515 et 04-3516 se sont révélés uniques dans la base de données canadienne PulseNet et celle du Center for Disease Control and Prevention (tableau 1), ce qui est probablement dû à la rareté de ce pathogène en Amérique du Nord. Les profils de bandes similaires chez ces deux isolats nous indiquent qu'il existe des différences génétiques qui s'ajoutent aux mutations ponctuelles encodées aux locus gyrA et parC, mais que dans l'ensemble, la parenté génétique est importante. Fait notable, l'isolat 04-3515 présentait un profil identique à celui des souches de S. dysenteriae de type 1 isolées précédemment en Asie méridionale(7). Bien que le patient n'ait signalé aucun voyage, cette similitude génétique indique que cette souche a également été transmise de l'Asie au Canada. En outre, nous avons observé des profils plasmidiques similaires entre les souches résistantes à la ciprofloxacine récemment isolées en Asie(7) et ces deux isolats canadiens.

Table 1. Antimicrobial susceptibility profiles and genetic analysis of Shigella dysenteriae type 1 isolated in June 2004, Alberta, Canada
Tableau 1. Profils de sensibilité aux antimicrobiens et analyse génétique de Shigella dysenteriae de type 1 isolée en juin 2004, en Alberta (Canada)

 

MIC (mg/L) a

QRDR Sequencing b

Strain Ac Ap Cip Nal St Su Tc Tm gyrA parC gyrB parE PFGE c Toxin d
 

CMI (mg/L) a

Séquençage des RRRQ

Souche Ac Ap Cip Nal St Su Tc Tm gyrA parC gyrB parE ECP c Toxine d
04-3515 16 32 0.015 1 64 256 32 4 wt wt wt wt J2PX01.0004 stx1
04-3515 16 32 4 32 64 256 32 4 S83L, D87N S80I wt wt J2PX01.0005 stx1

a Determined by Sensititre broth microdilution, and results indicating ‘susceptible’ by disc diffusion are underlined; Ac = amoxicillin/clavulanic Acid, Ap = ampicillin, Cm = chloramphenicol, Cip = ciprofloxacin, Nal = nalidixic acid, St = streptomycin, Su = sulfamethoxoasole, Tc = tetracycline, Tm = trimethoprim   b Quinolone resistance-determining regions were amplified and sequenced using primers as described in the text; ‘wt’ = wild-type in reference to S. dysenteriae M131649 (accession: NC_004510).
c Pulsed-field gel electrophoresis after XbaI digestion; pattern numbers as provided by the Center for Disease Control and Prevention, Atlanta, U.S.   d Toxin genotype and phenotype, determined by standard PCR and cell cytotoxicity procedures  

a Déterminée par microdilution en milieu liquide Sensititre; les résultats indiquant une sensibilité par diffusion en gélose sont soulignés; Ac = amoxicilline/acide clavulanique, Ap = ampicilline, Cm = chloramphénicol, Cip = ciprofloxacine, Nal = acide nalidixique, St = streptomycine, Su = sulfaméthoxoasole, Tc = tétracycline, Tm = triméthoprime   b Les régions responsables de la résistance aux quinolones ont été amplifiées et séquencées à l’aide des amorces décrites dans le texte; « wt » = type sauvage ( S. dysenteriae M131649, no NC_004510).
c Électrophorèse en champ pulsé après digestion par Xbal; numéros de profil fournis par le Center for Disease Control and Prevention, Atlanta, É.-U.   d Génotype et phénotype de la toxine déterminés par PCR standard et par cytotoxicité cellulaire.
   

Conclusions

La présente étude indique que les voyages peuvent être responsables de l'introduction de souches de S. dysenteriae de type 1 multirésistantes d'origine étrangère chez d'autres populations du globe. Des clones dominants de S. dysenteriae de type 1 résistants à la ciprofloxacine ont été observés en Asie du Sud-Est(1,11), et des souches récemment isolées au Canada se sont révélées similaires aux isolats asiatiques, comme en témoignent les données séquentielles des RRRQ au locus gyrA et les profils de bandes Xbal d'ECP. Nous n'avons aucune preuve de transmission de la maladie à la population locale par les personnes infectées, mais l'apparition de souches multirésistantes nécessite une surveillance accrue et la déclaration de S. dysenteriae au Canada et ailleurs dans le monde. Nous encourageons tous les centres de santé à présenter toute souche de S. dysenteriae présumée aux laboratoires provinciaux et nationaux.

Remerciements

Nous remercions P. Tilley et M. Louie du Laboratoire de santé provincial de l'Alberta qui nous ont fourni les souches; le DNA Core unit du LNM qui a synthétisé les oligonucléotides et séquencé l'ADN; D. Kuntz et D. Janella qui ont effectué les épreuves de sensibilité; W. Demczuk, M. Boyd et L Tschetter qui ont fourni les données relatives aux souches; P. Backhouse qui a effectué une révision critique du présent manuscrit et G.B. Nair qui nous a communiqué des données.

Références

  1. Pazhani GP, Sarkar B, Ramamurthy T et coll. Clonal multidrug-resistant Shigella dysenteriae type 1 strains associated with epidemic and sporadic dysenteries in eastern India. Antimicrob Agents Chemother 2004;48:681-84.
  2. Naheed A, Kalluri P, Talukder KA et coll. Fluoroquinolone-resistant Shigella dysenteriae type 1 in northeastern Bangladesh. Lancet Infect Dis 2004;4:607-08.
  3. Dutta S, Dutta P, Matsushita S et coll. Shigella dysenteriae serotype 1, Kolkata, India. Emerg Infect Dis 2003;9:1471-74.
  4. Gupta A, Polyak CS, Bishop RD et coll. Laboratory-confirmed Shigellosis in the United States, 1989-2002: Epidemiologic trends and patterns. Clin Infect Dis 2004;38:1372-77.
  5. Everett MJ, Jin YF, Ricci V et coll. Contributions of individual mechanisms to fluoroquinolone resistance in 36 Escherichia coli strains isolated from humans and animals. Antimicrob Agents Chemother 1996;40:2380-86.
  6. Giraud E, Brisabois A, Martel JL et coll. Comparative studies of mutations in animal isolates and experimental in vitro- and in vivo-selected mutants of Salmonella spp. suggest a counterselection of highly fluoroquinolone-resistant strains in the field. Antimicrob Agents Chemother 1999;43:2131-37.
  7. Talukder KA, Khajanchi BK, Islam MA et coll. Genetic relatedness of ciprofloxacin-resistant Shigella dysenteriae type 1 strains isolated in south Asia. J Antimicrob Chemother 2004;54:730-34.
  8. Eaves DJ, Randall L, Gray DT et coll. Prevalence of mutations within the quinolone resistance-determining region of gyrA, gyrB, parC, and parE and association with antibiotic resistance in quinolone-resistant Salmonella enterica. Antimicrob Agents Chemother 2004;48:4012-15.
  9. Yang H, Chen S, White DG et coll. Characterization of multipleantimicrobial- resistant Escherichia coli isolates from diseased chickens and swine in China. J Clin Microbiol 2004;42:3483-89.
  10. Dutta S, Kawamura Y, Ezaki T et coll. Alteration in the GyrA subunit of DNA gyrase and the ParC subunit of topoisomerase IV in Quinoloneresistant Shigella dysenteriae serotype 1 clinical isolates from Kolkata, India. Antimicrob Agents Chemother 2005;49:1660-61.
  11. Dutta S, Ghosh A, Ghosh K et coll. Newly emerged multiple-antibioticresistant Shigella dysenteriae type 1 strains in and around Kolkata, India, are clonal. J Clin Microbiol 2003;41:5833-34.

Source : M Gilmour, PhD et T Cote, Programme des bactéries pathogènes émergentes; D Woodward, BSc et L-K Ng, PhD, Programme de bactériologie et de maladies entériques, Laboratoire national de microbiologie, Winnipeg (Manitoba), Agence de la santé publique du Canada.


Signaler un problème ou une erreur sur cette page
Veuillez sélectionner toutes les cases qui s'appliquent :

Merci de votre aide!

Vous ne recevrez pas de réponse. Pour toute question, contactez-nous.

Date de modification :