Detection of SARS-CoV-2 Delta variant in Canadian wastewater

CCDR

Volume 49-5, May 2023: Innovative Technologies in Public Health

Surveillance

Real-time quantitative reverse transcription polymerase chain reaction detection of SARS-CoV-2 Delta variant in Canadian wastewater

Shelley Peterson1, Jade Daigle1, Codey Dueck1, Audra Nagasawa2, Michael Mulvey1,3, Chand S Mangat1

Affiliations

1 Wastewater Surveillance Unit, National Microbiology Laboratory, Public Health Agency of Canada, Winnipeg, MB

2 Centre for Population Health Data, Statistics Canada, Ottawa, ON

3 Department of Medical Microbiology and Infectious Diseases, Max Rady College of Medicine, University of Manitoba, Winnipeg, MB

Correspondence

chand.mangat@phac-aspc.gc.ca

Suggested citation

Peterson SW, Daigle J, Dueck C, Nagasawa A, Mulvey MR, Mangat CS. Real-time quantitative reverse transcription polymerase chain reaction detection of SARS-CoV-2 Delta variant in Canadian wastewater. Can Commun Dis Rep 2023;49(5):213–20. https://doi.org/10.14745/ccdr.v49i05a07

Keywords: SARS-CoV-2, wastewater, variant, Delta, B.1.617.2, qPCR

Abstract

Background: Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) variants of concern are associated with increased infectivity, severity, and mortality of coronavirus disease 2019 (COVID-19) and have been increasingly detected in clinical and wastewater surveillance in Canada and internationally. In this study, we present a real-time quantitative reverse transcription polymerase chain reaction (RT-qPCR) assay for detection of the N gene D377Y mutation associated with the SARS-CoV-2 Delta variant in wastewater.

Methods: Wastewater samples (n=980) were collected from six cities and 17 rural communities across Canada from July to November 2021 and screened for the D377Y mutation.

Results: The Delta variant was detected in all major Canadian cities and northern remote regions, and half of the southern rural communities. The sensitivity and specificity of this assay were sufficient for detection and quantitation of the Delta variant in wastewater to aid in rapid population-level screening and surveillance.

Conclusion: This study demonstrates a novel cost-effective RT-qPCR assay for tracking the spread of the SARS-CoV-2 Delta variant. This rapid assay can be easily integrated into current wastewater surveillance programs to aid in population-level variant tracking.

Introduction

The severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) pandemic began in Wuhan, China in late 2019 before becoming a worldwide pandemic in 2020. Beginning in September 2020, variants of concern (VOC) began to emerge which had mutations leading to increased viral transmission rates, increased virulence, or the ability to escape existing vaccines Footnote 1 Footnote 2 Footnote 3 Footnote 4. On May 11, 2021, the World Health Organization declared the Delta variant (B.1.617.2) to be a VOC Footnote 5. The Delta variant has been shown to be both more transmissible and more virulent than the wild-type (WT) (Wuhan) strain Footnote 6 Footnote 7 Footnote 8.

Wastewater-based epidemiology (WBE) has proven to be a powerful tool for tracking the spread of SARS-CoV-2 on a population level, and recently has become instrumental in monitoring the dissemination of VOC across Canada and throughout the world Footnote 9 Footnote 10 Footnote 11 Footnote 12. The real-time quantitative reverse transcription polymerase chain reaction (RT-qPCR)-based assays have previously been developed to identify mutations associated with emerging VOC including Alpha (Sdel69-70, ND3L), Beta (Sdel241, N501Y) and Gamma (N501Y) Footnote 13 Footnote 14 Footnote 15. Early detection of VOC can potentially lead to improved public health responses, such as increased sequencing of clinical isolates, enhanced surveillance and enhanced public health measures. Monitoring relative amounts of SARS-CoV-2 variants over time can be useful for monitoring trends in viral transmission and potentially assessing the effectiveness of public health interventions Footnote 16.

In this report, we describe a novel RT-qPCR assay for detection of the N gene D377Y allele—associated with the Delta variant—in wastewater. We applied this assay to wastewater samples collected from 36 sampling locations drawn from 23 Canadian cities and towns, both remote and urban, to monitor the dissemination of the Delta variant throughout the country. This population-level surveillance approach could be instrumental for monitoring changes in VOC prevalence and effects of public health interventions for reduction of viral spread within health regions.

Methods

Sample collection and nucleic acid extraction

Wastewater was collected between June 30 and December 1, 2021, from 16 urban wastewater treatment plants (WWTP) from six cities along with 20 WWTP and lift stations from 17 towns and rural locations in Canada. Fifteen of the WWTP from five cities were sampled as part of Statistics Canada's Canadian Wastewater Survey Footnote 17. A 24-hour composite sample was collected three times per week at each treatment facility and shipped to the National Microbiology Laboratory at 4°C. The samples were stored at 4°C for up to 24 hours until processed.

A 300 ml sample of primary post-grit influent or raw wastewater was mixed by inversion, then a 30 mL aliquot was drawn and processed as previously described Footnote 14. RNA was extracted using the MagNA Pure 96 DNA and Viral NA Large Volume Kit (Roche Diagnostics, Laval, Québec) using the Plasma External Lysis 4.0 protocol as per manufacturer instructions.

Delta variant of concern assay design

An assay was developed to detect the D377Y mutation consisting of a G->T in the N gene (G29406T) due to relative rarity in the general Canadian population of SARS-CoV-2 genomes, and relative exclusivity within the Delta variant genome (personal communication, G. Van Domselaar). This assay was designed to detect both WT and variant (V) sequences for each allele, allowing for discrimination between V and WT SARS-CoV-2 RNA.

The WT SARS-CoV-2 (NC_045512.1) sequence, along with Delta variant sequences (EPI_ISL_1372093, EPI_ISL_2134533, EPI_ISL_2134644, EPI_ISL_2134933, EPI_ISL_2135087), were obtained from Global Initiative on Sharing Avian Influenza Data Footnote 18 and used for primer and probe design. Oligonucleotide primers and probes were chosen for each target region using Primer Express Software v3.0 (Thermo Fisher Scientific, Waltham, Massachusetts) and Primer3 v4.1.0 Footnote 19. Linear dsDNA oligonucleotide gene fragments (Integrated DNA, Coralville, Iowa) consisting of the gene region flanking the variant region for either the WT or variant sequence (Table A1) were employed as standards and quantified using a One-Step RT-ddPCR Advanced Kit for Probes (Bio-Rad, Mississauga, Ontario) on a QX200 Droplet Digital PCR System (Bio-Rad).

Real-time quantitative reverse transcription polymerase chain reaction assay conditions

RT-qPCR was performed for D377Y WT and V assays, along with the United States Centers for Disease Control and Prevention N1 and N2 assays and interpreted as previously described Footnote 14 Footnote 20 with concentrations of 500 nM of each primer (D377Y_F: CATTCCCACCAACAGAGCCT, D377Y_R: TGTCTCTGCGGTAAGGCTTG) and 500 nM of each probe (D377Y_WT: AGAAGGCTGATGAAA, D377Y_V: AGAAGGCTTATGAAAC). Each real-time PCR was performed in duplicate or triplicate as indicated with the appropriate non-template controls and positive controls.

Determination of limit of detection

The assay limit of detection (LOD) was assessed as the lowest concentration at which there was >95% test positivity in 15 replicates of a 1.5-fold serial dilution series from 45 copies/reaction (cp/rxn) to 1.8 cp/rxn of dsDNA oligonucleotide standards.

Data analyses

Amplification efficiencies (E) were calculated using E=−1 + 10(-1/slope) x 100. Data analyses were performed using R version 4.1.1 on Rstudio using the tidyverse packages Footnote 21.

Results

The assay limits of detection were 4 cp/rxn (WT) and 3 cp/rxn (V) when measured as a pure specimen without interfering alleles. These LODs were near the theoretical limit of RT-qPCR and sufficient for sensitive detection in wastewater, where SARS-CoV-2 RNA concentrations can be very low. Standard curves were as follows: WT (slope=−3.45, intercept=38.52, R2=0.999); and V (slope=−3.29, intercept=38.25, R2=0.999). The amplification efficiencies of the WT and V reactions were 101% and 95%, respectively.

As relative amounts of WT and V template within wastewater samples may vary considerably, standard curves were also created for each assay in the presence of 100, 500 and 1,000 cp/µL of the alternate allele to assess their stability (Figure 1). Presence of the WT template had a limited effect on V template detection with the variant assay, with a loss of signal at 1 cp/µL V only in the presence of 1,000 cp/µL WT; a concentration much higher than is likely to be detected in wastewater. Presence of V template led to decreased sensitivity and increased range of error of the WT assay, with detection at 10 cp/µL WT, but not 1 cp/µL WT in the presence of any concentration of V template. Standard deviations of both assays were determined using the alternate alleles in this experiment to assess variance over a range of concentrations. Standard deviations were averaged across three concentrations (100 cp/µL, 500 cp/µL and 1,000 cp/µL) and were 0.38 Ct (WT) and 0.31 (V) compared with 0.09–0.18 for previously published assays Footnote 14.

Figure 1: Standard curves for D377Y assays in the presence of the alternate genotype for each alleleFootnote a
Figure 1. Text version below.
Figure 1 - Text description
Copies Log copies Competitive copies Assay Locus Allele Rep1 Rep2 Rep3 Avg Stdev
10,000 4.699 - D377Y_WT D377Y WT 22.81 22.78 22.66 22.75 0.079646
1,000 3.699 - D377Y_WT D377Y WT 26.15 26.21 26.39 26.25 0.124343
100 2.699 - D377Y_WT D377Y WT 29.34 29.62 29.73 29.56 0.203482
10 1.699 - D377Y_WT D377Y WT 32.72 32.90 32.81 32.81 0.089652
1 0.699 - D377Y_WT D377Y WT 36.60 35.07 35.26 35.64 0.836539
10,000 4.699 100 D377Y_WT D377Y WT 21.87 21.97 22.38 22.07 0.267775
1,000 3.699 100 D377Y_WT D377Y WT 25.92 25.68 26.25 25.95 0.289072
100 2.699 100 D377Y_WT D377Y WT 29.61 29.26 29.47 29.45 0.176541
10 1.699 100 D377Y_WT D377Y WT 33.21 33.42 32.60 33.07 0.425187
1 0.699 100 D377Y_WT D377Y WT ND ND ND NA NA
10,000 4.699 500 D377Y_WT D377Y WT 23.14 23.14 23.34 23.21 0.115114
1,000 3.699 500 D377Y_WT D377Y WT 26.35 26.44 26.47 26.42 0.058017
100 2.699 500 D377Y_WT D377Y WT 30.19 29.88 30.42 30.16 0.268748
10 1.699 500 D377Y_WT D377Y WT 36.76 ND 36.06 36.41 0.493931
1 0.699 500 D377Y_WT D377Y WT ND ND ND NA NA
10,000 4.699 1,000 D377Y_WT D377Y WT 23.21 23.07 22.86 23.04 0.173106
1,000 3.699 1,000 D377Y_WT D377Y WT 25.34 25.51 26.32 25.72 0.527344
100 2.699 1,000 D377Y_WT D377Y WT 30.32 30.37 30.66 30.45 0.18057
10 1.699 1,000 D377Y_WT D377Y WT ND 38.21 ND 38.21 NA
1 0.699 1,000 D377Y_WT D377Y WT ND ND ND NA NA
10,000 4.699 - D377Y_V D377Y V 22.35 22.50 22.48 22.44 0.076794
1,000 3.699 - D377Y_V D377Y V 25.71 25.79 25.30 25.60 0.265688
100 2.699 - D377Y_V D377Y V 29.49 29.47 29.57 29.51 0.055552
10 1.699 - D377Y_V D377Y V 32.51 32.78 33.58 32.96 0.552422
1 0.699 - D377Y_V D377Y V 36.66 35.85 34.67 35.73 1.002303
10,000 4.699 100 D377Y_V D377Y V 21.65 21.48 21.01 21.38 0.334804
1,000 3.699 100 D377Y_V D377Y V 25.48 25.08 24.67 25.07 0.401667
100 2.699 100 D377Y_V D377Y V 28.96 28.98 28.88 28.94 0.05023
10 1.699 100 D377Y_V D377Y V 32.61 33.36 32.99 32.99 0.377475
1 0.699 100 D377Y_V D377Y V 38.04 37.95 36.90 37.63 0.632686
10,000 4.699 500 D377Y_V D377Y V 22.89 22.32 21.77 22.33 0.55805
1,000 3.699 500 D377Y_V D377Y V 26.24 26.00 26.09 26.11 0.121814
100 2.699 500 D377Y_V D377Y V 29.60 29.24 29.74 29.52 0.257033
10 1.699 500 D377Y_V D377Y V 34.75 33.79 34.84 34.46 0.58128
1 0.699 500 D377Y_V D377Y V ND ND 38.34 38.34 NA
10,000 4.699 1,000 D377Y_V D377Y V 21.42 21.63 20.89 21.31 0.378906
1,000 3.699 1,000 D377Y_V D377Y V 26.02 26.04 25.24 25.76 0.458344
100 2.699 1,000 D377Y_V D377Y V 30.76 29.91 30.20 30.29 0.429528
10 1.699 1,000 D377Y_V D377Y V 37.53 34.37 35.22 35.71 1.634639
1 0.699 1,000 D377Y_V D377Y V ND ND ND NA NA
Figure 1 abbreviations

Abbreviations: NA, not available; ND, not detected


To test analytical specificity, both WT and V targets were tested in triplicate against serial dilutions from 106 cp/µL to 100 cp/µL of the alternate allele oligonucleotide. The WT assay showed negligible cross-reactivity, with a 25 Ct delayed detection in the presence of 1 x 106 cp/µL WT. The V assay showed cross reactivity with the WT template; however, the amplification was delayed by ~8 Ct (Figure 2).

Figure 2: Standard curvesFootnote a Footnote b Footnote c for the D377Y real-time polymerase chain reaction assays performed with serial dilutions of synthetic DNA oligonucleotides for the wild-type and D377Y variant alleles
Figure 2. Text version below.
Figure 2 - Text description
Copies Log copies Competitive copies Locus Allele Template Rep1 Rep2 Rep3 Avg Stdev
1,000,000 6.699 0 D377Y V V 16.23 16.13 16.12 16.16 0.063428
100,000 5.699 0 D377Y V V

19.42

19.11

19.55

19.36 0.227545
10,000 4.699 0 D377Y V V 22.81 22.78 22.66 22.75 0.079646
1,000 3.699 0 D377Y V V 26.15 26.21 26.39 26.25 0.124343
100 2.699 0 D377Y V V 29.34 29.62 29.73 29.56 0.203482
10 1.699 0 D377Y V V 32.72 32.90 32.81 32.81 0.089652
1 0.699 0 D377Y V V 36.60 35.07 35.26 35.64 0.836539
1,000,000 6.699 0 D377Y V WT

24.42

23.44

24.40

24.09 0.56325
100,000 5.699 0 D377Y V WT

27.96

27.54

27.62

27.70 0.225158
10,000 4.699 0 D377Y V WT 31.38 31.72 31.26 31.45 0.239828
1,000 3.699 0 D377Y V WT 34.12 35.26 35.14 34.84 0.621706
100 2.699 0 D377Y V WT 37.61 38.65 38.06 38.10 0.518656
10 1.699 0 D377Y V WT 42.65 42.34 42.14 42.38 0.25774
1 0.699 0 D377Y V WT ND ND ND NA NA
1,000,000 6.699 0 D377Y WT WT

15.53

15.10

15.50

15.38 0.237491
100,000 5.699 0 D377Y WT WT

18.82

18.71

18.80

18.78 0.057041
10,000 4.699 0 D377Y WT WT 22.35 22.50 22.48 22.44 0.076794
1,000 3.699 0 D377Y WT WT 25.71 25.79 25.30 25.60 0.265688
100 2.699 0 D377Y WT WT 29.49 29.47 29.57 29.51 0.055552
10 1.699 0 D377Y WT WT 32.51 32.78 33.58 32.96 0.552422
1 0.699 0 D377Y WT WT 36.66 35.85 34.67 35.73 1.002303
1,000,000 6.699 0 D377Y WT V ND

39.86

ND 39.86 NA
100,000 5.699 0 D377Y WT V ND ND ND NA NA
10,000 4.699 0 D377Y WT V ND ND ND NA NA
1,000 3.699 0 D377Y WT V ND ND ND NA NA
100 2.699 0 D377Y WT V ND ND ND NA NA
10 1.699 0 D377Y WT V ND ND ND NA NA
1 0.699 0 D377Y WT V ND ND ND NA NA
Figure 2 abbreviations

Abbreviations: NA, not available; ND, not detected


A total of 980 samples from 36 urban and remote WWTPs and lift stations across Canada were sampled from June 30 to December 1, 2021 (Table A2). Of these, 539 (55%) tested positive for the SARS-CoV-2 Delta variant D377Y mutation, 210 (21.4%) tested positive for N1/N2 only and 232 (23.6%) samples were negative for both N1/N2 and D377Y. Additionally, there were 8 (0.8%) samples in which SARS-CoV-2 was detected by the D377Y assays but not N1/N2, of which seven had D377Y detection in only one of two replicates and six had detection <10 cp/mL. The Delta variant was detected in all six major cities, with initial detection ranging from July 11 to August 30 in the larger cities and October 7 in NL11 (St. John's) (Figure 3). Delta variant signal was initially detected in the majority of cities between July 17 and 22. The peak signal (highest concentration of Delta detected) in the cities throughout the study period ranged from July 22 to October 18, averaging 32 days after initial detection (range: 0–66, IQR: 10–49). Following initial detection in five of the six cities, Delta signal rapidly increased, becoming roughly equivalent to the SARS-CoV-2 N1 + N2 signal throughout the remainder of the study period. This sharp increase is indicative of rapid displacement of other circulating variants by Delta, as seen in clinical cases by genomic surveillance of SARS-CoV-2 variants. In St. John's, Newfoundland and Labrador, Delta signal was detected only twice during the study period and SARS-CoV-2 signal remained low; a pattern typically seen in the more remote locations in this study.

Figure 3: Detection of SARS-CoV-2 Delta variant in wastewater from Canadian cities and rural areas using real-time quantitative reverse transcription polymerase chain reactionFootnote a Footnote b
Figure 3. Text version below.
Figure 3 - Text description
Sample_ID Site Date_sampled S_N1N2_avg S_D377Y_Var_avg
WW21-2384 AB1 2021-07-08 3 1
WW21-2385 AB1 2021-07-11 3 1
WW21-2386 ON1 2021-07-11 4.5 3
WW21-2387 ON2 2021-07-11 5.1 1
WW21-2388 ON3 2021-07-11 3 1
WW21-2389 ON4 2021-07-11 1 1
WW21-2390 NL11 2021-07-13 1 1
WW21-2393 NS1 2021-07-05 1 1
WW21-2394 NS2 2021-07-05 4 1
WW21-2395 NS3 2021-07-05 3 1
WW21-2396 NS1 2021-07-07 3 1
WW21-2397 NS2 2021-07-07 4.4 1
WW21-2398 NS3 2021-07-08 1 1
WW21-2412 ON1 2021-07-15 3.2 1
WW21-2413 ON2 2021-07-15 3 1
WW21-2414 ON3 2021-07-15 5.7 1
WW21-2415 ON4 2021-07-15 1 1
WW21-2417 NL11 2021-07-15 1 1
WW21-2421 QC1 2021-07-14 3 1
WW21-2422 QC2 2021-07-14 5 1
WW21-2423 QC1 2021-07-17 3 1
WW21-2424 QC2 2021-07-17 3 1
WW21-2436 NL11 2021-07-19 1 1
WW21-2449 ON1 2021-07-18 3 1
WW21-2450 ON2 2021-07-18 6.5 12.9
WW21-2451 ON3 2021-07-18 6.2 4.3
WW21-2452 ON4 2021-07-18 3 1
WW21-2453 AB1 2021-07-15 3 1
WW21-2454 AB1 2021-07-18 7 3.2
WW21-2458 NT5 2021-06-30 1 1
WW21-2459 NT5 2021-07-07 1 1
WW21-2470 BC1 2021-07-15 3 1
WW21-2471 BC2 2021-07-15 6.2 1
WW21-2472 BC4 2021-07-15 3 1
WW21-2473 BC3 2021-07-15 3 1
WW21-2474 BC5 2021-07-15 5.5 1
WW21-2475 BC1 2021-07-18 4.5 1
WW21-2476 BC2 2021-07-18 3 1
WW21-2477 BC4 2021-07-18 3.3 1
WW21-2478 BC3 2021-07-18 4.7 1
WW21-2479 BC5 2021-07-18 3 1
WW21-2480 NS1 2021-07-12 1 1
WW21-2481 NS2 2021-07-12 4.1 1
WW21-2482 NS3 2021-07-12 3 1
WW21-2483 NS1 2021-07-14 1 1
WW21-2484 NS2 2021-07-14 3 1
WW21-2485 NS3 2021-07-14 1 1
WW21-2501 NU1 2021-07-14 1 1
WW21-2502 NU1 2021-07-16 1 1
WW21-2503 NU1 2021-07-19 1 1
WW21-2506 ON1 2021-07-20 4.5 1
WW21-2507 ON2 2021-07-20 3.9 1
WW21-2508 ON3 2021-07-20 7.1 7.2
WW21-2509 ON4 2021-07-20 1 1
WW21-2510 NL10 2021-07-22 1 1
WW21-2512 NL11 2021-07-22 1 1
WW21-2515 NU2 2021-07-22 1 1
WW21-2520 BC1 2021-07-22 8.9 15.2
WW21-2521 BC2 2021-07-22 5.9 3
WW21-2522 BC3 2021-07-22 3 3
WW21-2523 BC4 2021-07-22 52.3 102
WW21-2524 BC5 2021-07-22 7.6 22.9
WW21-2525 BC1 2021-07-25 3.7 3
WW21-2526 BC2 2021-07-25 5.6 1
WW21-2527 BC3 2021-07-25 6.6 9.6
WW21-2528 BC4 2021-07-25 9.7 14
WW21-2529 BC5 2021-07-25 3 1
WW21-2530 QC1 2021-07-21 3 3.9
WW21-2531 QC2 2021-07-21 3 1
WW21-2532 QC1 2021-07-24 4 1
WW21-2533 QC2 2021-07-24 4.5 1
WW21-2544 NL11 2021-07-26 1 1
WW21-2547 NU1 2021-07-21 1 1
WW21-2558 ON1 2021-07-25 4.5 3
WW21-2559 ON2 2021-07-25 4.5 1
WW21-2560 ON3 2021-07-25 8.9 8.4
WW21-2561 ON4 2021-07-25 3 1
WW21-2562 AB1 2021-07-22 3.5 3.4
WW21-2563 AB1 2021-07-25 7.7 3
WW21-2564 NS1 2021-07-19 3 1
WW21-2565 NS2 2021-07-19 1 1
WW21-2566 NS3 2021-07-19 3 1
WW21-2567 NS1 2021-07-22 1 1
WW21-2568 NS2 2021-07-22 3 1
WW21-2569 NS3 2021-07-22 3 1
WW21-2589 NU2 2021-07-26 1 1
WW21-2590 NU2 2021-07-27 1 1
WW21-2591 ON1 2021-07-27 3.9 1
WW21-2592 ON2 2021-07-27 36.9 69
WW21-2593 ON4 2021-07-27 3 1
WW21-2595 NL11 2021-07-29 3 1
WW21-2608 NL11 2021-08-02 1 1
WW21-2615 NU1 2021-07-28 3 1
WW21-2616 NL10 2021-07-30 1 1
WW21-2619 BC2 2021-07-29 8.1 1
WW21-2620 BC3 2021-07-29 8.3 12.3
WW21-2621 BC4 2021-07-29 4.8 5
WW21-2622 BC5 2021-07-29 17.7 56.9
WW21-2623 BC1 2021-08-01 4.7 1
WW21-2624 BC2 2021-08-01 5.1 21
WW21-2625 BC3 2021-08-01 5.9 20.8
WW21-2626 BC4 2021-08-01 5.1 3
WW21-2627 BC5 2021-08-01 45.6 4.5
WW21-2628 ON1 2021-08-01 3.6 6.2
WW21-2629 ON2 2021-08-01 3 1
WW21-2630 ON3 2021-08-01 9.1 20.6
WW21-2631 ON4 2021-08-01 3.4 1
WW21-2632 QC1 2021-07-28 4.2 1
WW21-2633 QC2 2021-07-28 3 1
WW21-2634 QC1 2021-07-31 3.7 1
WW21-2635 QC2 2021-07-31 3 1
WW21-2647 NU2 2021-07-28 1 1
WW21-2648 NU2 2021-07-29 1 1
WW21-2652 AB1 2021-07-29 10.7 13.4
WW21-2653 AB1 2021-08-01 11.8 6.3
WW21-2665 NU2 2021-08-03 1 1
WW21-2668 ON1 2021-08-03 9.1 9
WW21-2669 ON2 2021-08-03 10.4 4.3
WW21-2670 ON3 2021-08-03 13.5 3
WW21-2671 ON4 2021-08-03 3 3
WW21-2672 NS1 2021-07-26 3 1
WW21-2673 NS2 2021-07-26 1 1
WW21-2674 NS3 2021-07-26 3 1
WW21-2675 NS1 2021-07-28 1 1
WW21-2676 NS2 2021-07-28 3 1
WW21-2677 NS3 2021-07-28 1 1
WW21-2681 NU2 2021-08-04 1 1
WW21-2682 NU2 2021-08-05 1 1
WW21-2688 BC1 2021-08-05 16.2 22.3
WW21-2689 BC2 2021-08-05 25.7 52
WW21-2690 BC3 2021-08-05 19.9 56.2
WW21-2691 BC4 2021-08-05 14.7 7.9
WW21-2692 BC5 2021-08-05 18.9 27
WW21-2693 BC1 2021-08-08 13.6 11.1
WW21-2694 BC2 2021-08-08 6.4 10
WW21-2695 BC3 2021-08-08 52.4 82.8
WW21-2696 BC4 2021-08-08 7.8 12
WW21-2697 BC5 2021-08-08 10.6 17.9
WW21-2698 QC1 2021-08-04 6.5 1
WW21-2699 QC2 2021-08-04 8.1 1
WW21-2700 QC1 2021-08-07 9.6 3
WW21-2701 QC2 2021-08-07 3.3 1
WW21-2702 NS1 2021-08-02 3 1
WW21-2703 NS2 2021-08-02 3 1
WW21-2704 NS3 2021-08-02 1 1
WW21-2705 NS1 2021-08-04 1 1
WW21-2706 NS2 2021-08-04 7 3
WW21-2707 NS3 2021-08-04 1 1
WW21-2718 NL11 2021-08-09 1 1
WW21-2722 NU1 2021-08-04 1 1
WW21-2723 NU1 2021-08-06 1 1
WW21-2724 NT5 2021-07-30 1 1
WW21-2725 NT5 2021-08-03 1 1
WW21-2726 NT5 2021-08-01 1 1
WW21-2733 AB1 2021-08-05 27.6 73.2
WW21-2734 AB1 2021-08-08 19.5 25.7
WW21-2735 ON1 2021-08-08 14.5 15.7
WW21-2736 ON2 2021-08-08 6.5 6.8
WW21-2737 ON3 2021-08-08 10.1 14.8
WW21-2738 ON4 2021-08-08 6.6 1
WW21-2758 ON1 2021-08-10 18.5 31.5
WW21-2759 ON2 2021-08-10 13.4 1
WW21-2760 ON3 2021-08-10 10.5 5.7
WW21-2761 ON4 2021-08-10 12.4 9.4
WW21-2762 NL11 2021-08-12 1 1
WW21-2764 NL10 2021-08-12 3 1
WW21-2775 NL10 2021-08-12 64.1 1
WW21-2776 NU2 2021-08-09 1 1
WW21-2777 NU2 2021-08-10 1 1
WW21-2778 NU2 2021-08-11 1 1
WW21-2781 BC1 2021-08-12 13.1 11.6
WW21-2782 BC2 2021-08-12 21.8 18
WW21-2783 BC3 2021-08-12 28.4 40.3
WW21-2784 BC4 2021-08-12 4.8 3
WW21-2785 BC5 2021-08-12 18.4 22.3
WW21-2786 BC1 2021-08-15 14 15.3
WW21-2787 BC3 2021-08-15 19.1 10.1
WW21-2788 BC4 2021-08-15 6.9 6
WW21-2789 BC5 2021-08-15 10.2 3
WW21-2790 QC1 2021-08-11 12.9 15.1
WW21-2791 QC2 2021-08-11 9.8 3
WW21-2792 QC1 2021-08-14 13.7 4.8
WW21-2793 QC2 2021-08-14 6.6 1
WW21-2804 NL11 2021-08-16 1 1
WW21-2807 AB1 2021-08-12 51.1 54.3
WW21-2808 AB1 2021-08-15 46.6 74.5
WW21-2809 ON1 2021-08-15 23.9 44.7
WW21-2810 ON2 2021-08-15 16.1 30.5
WW21-2811 ON3 2021-08-15 52.6 86.7
WW21-2812 ON4 2021-08-15 22.1 37.2
WW21-2816 NS1 2021-08-09 1 1
WW21-2817 NS2 2021-08-09 3 1
WW21-2818 NS3 2021-08-09 1 1
WW21-2819 NS1 2021-08-11 5.2 1
WW21-2820 NS2 2021-08-11 3.8 1
WW21-2821 NS3 2021-08-11 1 1
WW21-2833 ON1 2021-08-17 34.1 33.6
WW21-2834 ON2 2021-08-17 21.2 22.4
WW21-2835 ON3 2021-08-17 20 25.3
WW21-2836 ON4 2021-08-17 10.6 7.1
WW21-2837 NL11 2021-08-19 3 1
WW21-2840 NL10 2021-08-19 3 1
WW21-2841 NU1 2021-08-09 1 1
WW21-2842 NU1 2021-08-11 1 1
WW21-2843 NU1 2021-08-13 1 1
WW21-2844 NU1 2021-08-16 1 1
WW21-2845 NU2 2021-08-16 1 1
WW21-2846 NU2 2021-08-17 42.5 63.1
WW21-2915 NL11 2021-08-26 3 1
WW21-2918 NL10 2021-08-26 3 1
WW21-2919 NU1 2021-08-20 1 1
WW21-2920 NU1 2021-08-23 1 1
WW21-2921 NU2 2021-08-25 3 1
WW21-2922 NU2 2021-08-26 1 1
WW21-2923 ON1 2021-08-24 7.3 11.1
WW21-2924 ON2 2021-08-24 13.1 11.6
WW21-2925 ON3 2021-08-24 15.8 20
WW21-2926 ON4 2021-08-24 10.2 4.8
WW21-2929 NT3 2021-08-16 1 3
WW21-2930 NT4 2021-08-16 3 1
WW21-2931 NT5 2021-08-12 1 3
WW21-2932 NT5 2021-08-13 3 1
WW21-2933 NT5 2021-08-16 3.6 1
WW21-2934 NT5 2021-08-17 3 3
WW21-2935 NU2 2021-08-28 1 1
WW21-2936 NU2 2021-08-29 1 1
WW21-2939 BC1 2021-08-26 24.5 49.3
WW21-2940 BC2 2021-08-26 38.9 87.9
WW21-2941 BC3 2021-08-26 38 53.3
WW21-2942 BC4 2021-08-26 16.1 32
WW21-2943 BC5 2021-08-26 38.6 63.9
WW21-2944 BC1 2021-08-29 18.3 31
WW21-2945 BC2 2021-08-29 18.6 40.4
WW21-2946 BC3 2021-08-29 24 46.9
WW21-2947 BC4 2021-08-29 5.6 15.5
WW21-2948 BC5 2021-08-29 13.8 17.8
WW21-2949 QC1 2021-08-25 12.1 20.7
WW21-2950 QC2 2021-08-25 7.9 8
WW21-2951 QC1 2021-08-28 15.1 30.4
WW21-2952 QC2 2021-08-28 13.5 7.9
WW21-2963 NL11 2021-08-30 3 1
WW21-2964 NL10 2021-08-30 8 6.1
WW21-2969 NT4 2021-08-19 40.2 97.8
WW21-2970 NT5 2021-08-18 4.2 5.3
WW21-2971 NT5 2021-08-19 2.9 10.8
WW21-2972 NT6 2021-08-19 4.2 3
WW21-2973 NT5 2021-08-20 4.1 12
WW21-2974 NT6 2021-08-20 3 5.1
WW21-2975 NT5 2021-08-21 9.3 13
WW21-2976 NT6 2021-08-21 3 3
WW21-2977 NT5 2021-08-22 5.2 6.8
WW21-2978 NT6 2021-08-22 3 3
WW21-2982 AB1 2021-08-26 72.7 119.5
WW21-2983 AB1 2021-08-29 63.2 71.4
WW21-2990 NU1 2021-08-25 3 1
WW21-2991 NU2 2021-08-27 3 1
WW21-2992 NU2 2021-08-30 1 1
WW21-2996 ON1 2021-08-29 75.9 152.8
WW21-2997 ON2 2021-08-29 10.2 5.4
WW21-2998 ON3 2021-08-29 13 9
WW21-2999 ON4 2021-08-29 6.9 3.5
WW21-3000 NS1 2021-08-23 3 1
WW21-3001 NS2 2021-08-23 4.9 1
WW21-3002 NS3 2021-08-23 3.3 1
WW21-3003 NS1 2021-08-25 3 1
WW21-3004 NS2 2021-08-25 4.4 1
WW21-3005 NS3 2021-08-25 3 1
WW21-3013 NU1 2021-08-27 3 1
WW21-3014 NU1 2021-08-30 1 1
WW21-3015 NU2 2021-08-31 3 3
WW21-3016 NU2 2021-09-01 3 1
WW21-3017 NU2 2021-09-02 1 1
WW21-3021 NL10 2021-09-02 1 3
WW21-3023 NL11 2021-09-02 1 1
WW21-3048 BC1 2021-09-02 23.1 33.7
WW21-3049 BC2 2021-09-02 38.8 80.9
WW21-3050 BC3 2021-09-02 36.7 42.2
WW21-3051 BC4 2021-09-02 20.1 23.9
WW21-3052 BC5 2021-09-02 21.4 26.3
WW21-3053 BC1 2021-09-05 39.4 56.5
WW21-3054 BC2 2021-09-05 23.9 28.7
WW21-3055 BC3 2021-09-05 29 32.9
WW21-3056 BC4 2021-09-05 15.2 23.8
WW21-3057 BC5 2021-09-05 93.3 111.1
WW21-3058 QC1 2021-09-01 17 20.1
WW21-3059 QC2 2021-09-01 6.6 12.8
WW21-3060 QC1 2021-09-04 15.7 21.9
WW21-3061 QC2 2021-09-04 5.7 10.6
WW21-3068 NL11 2021-09-07 3 1
WW21-3069 NU2 2021-09-07 6.8 1
WW21-3074 AB1 2021-09-02 194.2 210.4
WW21-3075 AB1 2021-09-05 168.2 259.4
WW21-3076 NS1 2021-08-30 3 4
WW21-3077 NS2 2021-08-30 1 3.2
WW21-3078 NS3 2021-08-30 3 3
WW21-3079 NS1 2021-09-01 3 1
WW21-3080 NS2 2021-08-30 3 1
WW21-3081 NS3 2021-09-01 3 1
WW21-3090 NU2 2021-09-08 3 258
WW21-3091 NU2 2021-09-09 1 1
WW21-3094 NL11 2021-09-09 1 1
WW21-3095 NL10 2021-09-09 3 3
WW21-3104 NU1 2021-09-01 3 1
WW21-3105 NU1 2021-09-03 1 1
WW21-3106 NU1 2021-09-08 1 1
WW21-3109 BC1 2021-09-09 35.8 62.3
WW21-3110 BC2 2021-09-09 30.1 62.1
WW21-3111 BC3 2021-09-09 46.2 93.7
WW21-3112 BC4 2021-09-09 5.9 6.5
WW21-3113 BC5 2021-09-09 47.6 74.1
WW21-3114 BC1 2021-09-12 90.8 138.6
WW21-3115 BC2 2021-09-12 64.7 128
WW21-3116 BC3 2021-09-12 77 167.1
WW21-3117 BC4 2021-09-12 11.3 22.4
WW21-3118 BC5 2021-09-12 22.4 39.4
WW21-3119 QC1 2021-09-08 30.2 43.3
WW21-3120 QC2 2021-09-08 12.7 14.2
WW21-3121 QC1 2021-09-11 30.1 41.2
WW21-3122 QC2 2021-09-11 10.9 9.2
WW21-3132 NL11 2021-09-13 3 1
WW21-3140 AB1 2021-09-09 86.8 116.8
WW21-3141 AB1 2021-09-12 114.5 161.6
WW21-3142 ON1 2021-09-12 23.8 42.1
WW21-3143 ON2 2021-09-12 23 19.7
WW21-3144 ON3 2021-09-12 16.4 17
WW21-3145 ON4 2021-09-12 20.6 22.1
WW21-3159 NS1 2021-09-06 3 6.8
WW21-3160 NS2 2021-09-06 75.8 144.3
WW21-3161 NS3 2021-09-06 3.7 1
WW21-3162 NS1 2021-09-08 3 1
WW21-3163 NS2 2021-09-08 13.4 43
WW21-3164 NS3 2021-09-08 3 3
WW21-3175 NT5 2021-08-23 4.5 5.2
WW21-3176 NT6 2021-08-23 5 3
WW21-3177 NT5 2021-08-24 4.3 11.6
WW21-3178 NT6 2021-08-24 3 1
WW21-3179 NT5 2021-08-25 3.4 8.1
WW21-3180 NT6 2021-08-25 4.3 8.5
WW21-3181 NT5 2021-08-26 3 3
WW21-3182 NT6 2021-08-26 7.2 20.7
WW21-3183 NT3 2021-08-25 6.8 19.3
WW21-3184 NT4 2021-08-19 26.9 8.1
WW21-3185 NT4 2021-08-23 55.6 66.6
WW21-3186 NT4 2021-08-26 67.1 69.8
WW21-3189 NU2 2021-09-13 1 7.5
WW21-3190 NU2 2021-09-14 1 1
WW21-3191 NU1 2021-09-06 1 1
WW21-3192 NU1 2021-09-10 1 4.3
WW21-3193 NL11 2021-09-16 3 1
WW21-3197 NL10 2021-09-16 3 1
WW21-3199 ON1 2021-09-14 13.6 54.8
WW21-3200 ON2 2021-09-14 15.6 25.2
WW21-3201 ON3 2021-09-14 15.2 37.4
WW21-3202 ON4 2021-09-14 34.3 94.9
WW21-3205 BC1 2021-09-16 25 19.8
WW21-3206 BC2 2021-09-16 22.1 9.8
WW21-3207 BC3 2021-09-16 36.9 31.9
WW21-3208 BC4 2021-09-16 12.3 12.4
WW21-3209 BC5 2021-09-16 27.8 31.3
WW21-3210 BC1 2021-09-19 49.8 31.5
WW21-3211 BC2 2021-09-19 44.4 28.1
WW21-3212 BC3 2021-09-19 16.2 16.1
WW21-3213 BC4 2021-09-19 14.1 11.9
WW21-3214 BC5 2021-09-19 15.5 6.9
WW21-3215 QC1 2021-09-15 19.1 8.1
WW21-3216 QC2 2021-09-15 14.5 7.3
WW21-3217 QC1 2021-09-18 16.2 16.9
WW21-3218 QC2 2021-09-18 9 8.9
WW21-3229 NL11 2021-09-20 1 1
WW21-3236 NT5 2021-08-27 5 14.4
WW21-3237 NT5 2021-08-28 7 62.7
WW21-3238 NT5 2021-08-29 7.7 21.4
WW21-3239 NT5 2021-08-30 5.7 20.1
WW21-3240 NT5 2021-08-31 36.3 40.4
WW21-3241 NT5 2021-09-01 17.4 20.5
WW21-3242 NT5 2021-09-02 29.1 30
WW21-3243 NT5 2021-09-03 18.8 28.4
WW21-3244 NT5 2021-09-04 15 17.6
WW21-3245 NT5 2021-09-05 167 141.5
WW21-3246 NT5 2021-09-06 41.9 46.7
WW21-3247 NT5 2021-09-07 41.3 38.8
WW21-3248 NT5 2021-09-08 37.8 32.5
WW21-3249 NT5 2021-09-09 15.7 16
WW21-3250 NT5 2021-09-10 18.9 24.3
WW21-3251 NT5 2021-09-11 33.6 33.4
WW21-3252 NT5 2021-09-12 29.1 29.6
WW21-3253 NT5 2021-09-13 45.9 42.8
WW21-3254 NT5 2021-09-14 31.4 32.1
WW21-3255 NT6 2021-09-01 8.3 8.8
WW21-3256 NT6 2021-09-10 3 3.1
WW21-3257 NT6 2021-09-13 3 18.6
WW21-3258 NT3 2021-09-07 35.5 22.5
WW21-3259 NT4 2021-08-30 189 100.6
WW21-3260 NT4 2021-09-02 36.8 25.2
WW21-3261 NT4 2021-09-06 14.4 7.8
WW21-3262 NT4 2021-09-09 8.3 3
WW21-3270 NU2 2021-09-15 1 1
WW21-3271 NU2 2021-09-16 1 1
WW21-3272 NU2 2021-09-20 1 1
WW21-3273 NU2 2021-09-21 1 1
WW21-3274 NU1 2021-09-13 3 1
WW21-3275 NU1 2021-09-15 3 1
WW21-3280 AB1 2021-09-16 74.4 40.7
WW21-3281 AB1 2021-09-19 76.5 48
WW21-3282 ON1 2021-09-19 8.6 7.9
WW21-3283 ON2 2021-09-19 10.7 6.6
WW21-3284 ON3 2021-09-19 29.7 16.1
WW21-3285 ON4 2021-09-19 7.6 5.1
WW21-3286 NS1 2021-09-13 6.5 3
WW21-3287 NS2 2021-09-13 5.2 3
WW21-3288 NS3 2021-09-13 3 1
WW21-3289 NS1 2021-09-15 6.8 4.6
WW21-3290 NS2 2021-09-15 5 3
WW21-3291 NS3 2021-09-15 3 1
WW21-3306 NL11 2021-09-23 1 1
WW21-3309 NL10 2021-09-23 54.8 5.6
WW21-3311 NT5 2021-09-14 28.5 32.9
WW21-3312 NT5 2021-09-16 15.4 12.4
WW21-3313 NT5 2021-09-17 26.8 21.7
WW21-3314 NT6 2021-09-17 3.9 3.7
WW21-3315 NT5 2021-09-20 63.6 49.3
WW21-3316 NT6 2021-09-20 3.6 5.2
WW21-3317 NT3 2021-09-14 4.9 4.2
WW21-3318 NT3 2021-09-16 14.7 9.5
WW21-3319 NT4 2021-09-16 6.5 4.2
WW21-3324 NU2 2021-09-22 1 1
WW21-3325 NU2 2021-09-23 1 1
WW21-3330 NU1 2021-09-20 3 1
WW21-3335 QC1 2021-09-22 8.5 4.6
WW21-3336 QC2 2021-09-22 10.3 7.2
WW21-3337 QC1 2021-09-25 15.2 4.2
WW21-3338 QC2 2021-09-25 5.2 1
WW21-3349 NL11 2021-09-27 3 1
WW21-3353 BC1 2021-09-23 26.8 28.6
WW21-3354 BC2 2021-09-23 25.9 18
WW21-3355 BC3 2021-09-23 12.9 6.4
WW21-3356 BC4 2021-09-23 13.4 9.1
WW21-3357 BC5 2021-09-23 11.1 11.5
WW21-3358 BC1 2021-09-26 16.2 12.1
WW21-3359 BC2 2021-09-26 43.7 31.9
WW21-3360 BC3 2021-09-26 12.1 8.8
WW21-3361 BC4 2021-09-26 7.2 6.3
WW21-3362 BC5 2021-09-26 64.2 33.9
WW21-3363 AB1 2021-09-23 127.5 79.9
WW21-3364 AB1 2021-09-26 50.9 29.3
WW21-3365 NS1 2021-09-20 13.7 12.7
WW21-3366 NS2 2021-09-20 8.1 3
WW21-3367 NS3 2021-09-20 3 1
WW21-3368 NS1 2021-09-22 10.1 4.1
WW21-3369 NS2 2021-09-22 17.1 11
WW21-3370 NS3 2021-09-22 3.7 1
WW21-3382 ON1 2021-09-21 9.4 6.4
WW21-3383 ON2 2021-09-21 50.5 42.5
WW21-3384 ON3 2021-09-21 22.9 16.1
WW21-3385 ON4 2021-09-21 11.2 8.9
WW21-3386 ON1 2021-09-26 4.4 3
WW21-3387 ON2 2021-09-26 12.3 6.9
WW21-3388 ON3 2021-09-26 19.6 11.5
WW21-3389 ON4 2021-09-26 14.3 7.2
WW21-3400 NL11 2021-09-29 1 1
WW21-3404 NL10 2021-09-29 3 1
WW21-3408 NT5 2021-09-21 34.4 73.7
WW21-3409 NT6 2021-09-21 7.7 9.1
WW21-3410 NT5 2021-09-22 33.1 81.1
WW21-3411 NT6 2021-09-22 4.1 7.2
WW21-3412 NT5 2021-09-23 70.1 144.3
WW21-3413 NT6 2021-09-23 3.7 3
WW21-3414 NT5 2021-09-24 55.7 109.7
WW21-3415 NT6 2021-09-24 6.5 1
WW21-3416 NT3 2021-09-20 58.6 67.9
WW21-3417 NT3 2021-09-23 12.9 8.5
WW21-3418 NT3 2021-09-27 14.3 21.5
WW21-3419 NT4 2021-09-20 3 3
WW21-3421 NU1 2021-09-22 3 1
WW21-3422 NU1 2021-09-24 3 3.4
WW21-3423 NU1 2021-09-27 7.4 10.1
WW21-3424 NU2 2021-09-27 1 1
WW21-3425 NU2 2021-09-28 1 1
WW21-3426 NU2 2021-09-29 1 1
WW21-3430 QC1 2021-09-29 8.1 4.9
WW21-3431 QC2 2021-09-29 6.8 3
WW21-3432 QC1 2021-10-02 18.6 4.5
WW21-3433 QC2 2021-10-02 7.9 8
WW21-3444 NL11 2021-10-04 3 1
WW21-3445 NU1 2021-09-29 3 1
WW21-3448 NU2 2021-10-04 1 1
WW21-3449 NU2 2021-10-05 1 1
WW21-3454 BC1 2021-09-30 21.4 8.3
WW21-3455 BC2 2021-09-30 46.9 37.1
WW21-3456 BC3 2021-09-30 6.1 3.7
WW21-3457 BC4 2021-09-30 12.2 3
WW21-3458 BC5 2021-09-30 9.9 3.7
WW21-3459 BC1 2021-10-03 19.5 1
WW21-3460 BC2 2021-10-03 10.2 3
WW21-3461 BC3 2021-10-03 68.6 40.5
WW21-3462 BC4 2021-10-03 5.6 1
WW21-3463 BC5 2021-10-03 7.3 3
WW21-3464 AB1 2021-09-30 117.9 83.1
WW21-3465 AB1 2021-10-03 32.8 20.8
WW21-3466 ON1 2021-09-28 13.2 7.1
WW21-3467 ON2 2021-09-28 15.3 4.5
WW21-3468 ON3 2021-09-28 12.2 5.9
WW21-3469 ON4 2021-09-28 7.8 7.7
WW21-3476 NS1 2021-09-27 3.9 1
WW21-3477 NS2 2021-09-27 5.3 1
WW21-3478 NS3 2021-09-27 1 1
WW21-3479 NS1 2021-09-29 7.3 1
WW21-3480 NS2 2021-09-29 7.2 3
WW21-3481 NS3 2021-09-29 3 1
WW21-3482 ON1 2021-10-03 8.8 3.4
WW21-3483 ON2 2021-10-03 5.7 3
WW21-3484 ON3 2021-10-03 13.8 10.8
WW21-3485 ON4 2021-10-03 5.2 3
WW21-3499 NL6 2021-10-04 1 1
WW21-3510 NL11 2021-10-07 7.4 4
WW21-3512 NL10 2021-10-07 1 1
WW21-3515 NU2 2021-10-06 1 1
WW21-3516 NU2 2021-10-07 1 1
WW21-3517 NU1 2021-10-01 3 1
WW21-3518 NU1 2021-10-04 1 1
WW21-3521 ON1 2021-10-05 5.9 3
WW21-3522 ON2 2021-10-05 11.1 3.8
WW21-3523 ON3 2021-10-05 8.6 4.3
WW21-3524 ON4 2021-10-05 6.1 3
WW21-3540 BC1 2021-10-07 26.8 21.2
WW21-3541 BC2 2021-10-07 15.9 8.1
WW21-3542 BC3 2021-10-07 70.6 52.5
WW21-3543 BC4 2021-10-07 11.3 4.4
WW21-3544 BC5 2021-10-07 33.5 20.8
WW21-3545 BC1 2021-10-10 22.3 11
WW21-3546 BC2 2021-10-10 23.2 12.5
WW21-3547 BC3 2021-10-10 11.9 8.4
WW21-3548 BC4 2021-10-10 34.4 15.6
WW21-3549 BC5 2021-10-10 14.6 12.8
WW21-3550 QC1 2021-10-06 15.4 13.6
WW21-3551 QC2 2021-10-06 8.8 5
WW21-3552 QC1 2021-10-09 14.5 8.6
WW21-3553 QC2 2021-10-09 6.4 3.1
WW21-3554 NL11 2021-10-12 1 1
WW21-3563 NS1 2021-10-04 7.4 4.5
WW21-3564 NS2 2021-10-04 9.8 13.6
WW21-3565 NS3 2021-10-04 3 1
WW21-3566 NS1 2021-10-06 9 39.8
WW21-3567 NS2 2021-10-06 13.8 23.1
WW21-3568 NS3 2021-10-06 4 3
WW21-3569 ON1 2021-10-10 3.6 3.3
WW21-3570 ON2 2021-10-10 4.3 3
WW21-3571 ON3 2021-10-10 5.3 3.3
WW21-3572 ON4 2021-10-10 7.9 5.5
WW21-3579 NU1 2021-10-08 3 5
WW21-3580 NU2 2021-10-12 1 1
WW21-3587 AB1 2021-10-07 51.5 37.4
WW21-3588 AB1 2021-10-10 24.2 17.3
WW21-3591 NU1 2021-10-11 1 1
WW21-3592 NU2 2021-10-13 1 1
WW21-3593 NU2 2021-10-14 1 1
WW21-3595 NL11 2021-10-14 1 1
WW21-3597 NL10 2021-10-13 1 1
WW21-3602 NL6 2021-10-13 1 1
WW21-3613 ON1 2021-10-12 8.1 7.6
WW21-3614 ON2 2021-10-12 4.2 1
WW21-3615 ON3 2021-10-12 7.9 8.3
WW21-3616 ON4 2021-10-12 9.4 6.2
WW21-3617 NU1 2021-10-06 1 1
WW21-3620 QC1 2021-10-13 15.6 3
WW21-3621 QC2 2021-10-13 7.7 3
WW21-3622 QC1 2021-10-16 21.2 10.4
WW21-3623 QC2 2021-10-16 20.5 16.8
WW21-3639 NU1 2021-10-13 3 1
WW21-3640 NU1 2021-10-15 3.5 1
WW21-3645 BC1 2021-10-14 27 23.7
WW21-3646 BC2 2021-10-14 15 12
WW21-3647 BC3 2021-10-14 15.4 9.8
WW21-3648 BC4 2021-10-14 14.3 9.7
WW21-3649 BC5 2021-10-14 7.7 1
WW21-3650 BC1 2021-10-17 21.9 18.3
WW21-3651 BC2 2021-10-17 5.2 1
WW21-3652 BC3 2021-10-17 29.5 22.5
WW21-3653 BC4 2021-10-17 10.9 4.7
WW21-3654 BC5 2021-10-17 10.5 4.7
WW21-3655 AB1 2021-10-14 44.6 24.3
WW21-3656 AB1 2021-10-17 84 56.3
WW21-3657 NL11 2021-10-18 3 1
WW21-3663 ON1 2021-10-17 10.5 4.4
WW21-3664 ON2 2021-10-17 8.5 9.9
WW21-3665 ON3 2021-10-17 8 8.2
WW21-3666 ON4 2021-10-17 14.3 7.5
WW21-3679 NS1 2021-10-11 5.6 3.5
WW21-3680 NS2 2021-10-11 6.8 5.3
WW21-3681 NS3 2021-10-11 7.2 1
WW21-3682 NS1 2021-10-13 8.3 3.7
WW21-3683 NS3 2021-10-13 132.1 66.3
WW21-3684 NS3 2021-10-18 9.9 4.6
WW21-3685 NU2 2021-10-18 1 1
WW21-3686 NU2 2021-10-20 1 1
WW21-3688 ON1 2021-10-19 7.3 8
WW21-3689 ON2 2021-10-19 10.1 7.5
WW21-3690 ON3 2021-10-19 9.1 8.9
WW21-3691 ON4 2021-10-19 6.6 5.3
WW21-3693 NL11 2021-10-21 1 1
WW21-3696 NL10 2021-10-21 1 1
WW21-3701 NL6 2021-10-20 1 1
WW21-3736 BC1 2021-10-21 26.5 31.6
WW21-3737 BC2 2021-10-21 6.1 16.6
WW21-3738 BC3 2021-10-21 29.7 37.5
WW21-3739 BC4 2021-10-21 7.6 6.3
WW21-3740 BC5 2021-10-21 36 41.2
WW21-3741 BC1 2021-10-24 16.3 11.2
WW21-3742 BC2 2021-10-24 12.5 6.9
WW21-3743 BC3 2021-10-24 9 3
WW21-3744 BC4 2021-10-24 10.3 14.9
WW21-3745 BC5 2021-10-24 40.4 47.1
WW21-3746 AB1 2021-10-21 38.4 48.6
WW21-3747 AB1 2021-10-24 28.9 49
WW21-3748 NS2 2021-10-13 11 9.7
WW21-3749 NS1 2021-10-18 19.3 43.9
WW21-3750 NS2 2021-10-18 7 4.7
WW21-3751 NS1 2021-10-20 9.2 9.9
WW21-3752 NS2 2021-10-20 7 6.4
WW21-3753 NS3 2021-10-20 7.2 1
WW21-3763 ON1 2021-10-24 4.9 3
WW21-3764 ON2 2021-10-24 5.8 7.4
WW21-3765 ON3 2021-10-24 4.9 3
WW21-3766 ON4 2021-10-24 4.7 3.4
WW21-3773 NL11 2021-10-25 3 1
WW21-3775 NU1 2021-10-21 4 1
WW21-3776 NU1 2021-10-22 1 1
WW21-3777 NU2 2021-10-25 1 1
WW21-3778 NU2 2021-10-27 1 1
WW21-3781 NU1 2021-10-18 3 1
WW21-3783 NL6 2021-10-25 3 1
WW21-3788 ON1 2021-10-26 4.7 3
WW21-3789 ON2 2021-10-26 8.7 6.8
WW21-3790 ON3 2021-10-26 5.6 1
WW21-3791 ON4 2021-10-26 3 1
WW21-3793 NL11 2021-10-28 1 1
WW21-3798 NL10 2021-10-27 1 1
WW21-3805 QC1 2021-10-27 6.8 39.6
WW21-3806 QC2 2021-10-27 7.6 7.3
WW21-3807 QC1 2021-10-30 7.5 16.5
WW21-3808 QC2 2021-10-30 8.3 13.1
WW21-3819 NL11 2021-11-01 3 1
WW21-3824 NT3 2021-10-07 9.8 7.6
WW21-3825 NT3 2021-10-12 21 23.8
WW21-3826 NT3 2021-10-14 11.9 28.1
WW21-3827 NT3 2021-10-21 62 86.7
WW21-3828 NT3 2021-10-25 32.8 24.1
WW21-3839 BC1 2021-10-28 27.5 29.6
WW21-3840 BC2 2021-10-28 7.6 6.3
WW21-3841 BC3 2021-10-28 20.1 24
WW21-3842 BC4 2021-10-28 5.1 3.6
WW21-3843 BC5 2021-10-28 82.1 92.3
WW21-3844 BC1 2021-10-31 24.2 28.6
WW21-3845 BC2 2021-10-31 14.7 9.4
WW21-3846 BC3 2021-10-31 8.1 4.6
WW21-3847 BC4 2021-10-31 9.3 11.3
WW21-3848 BC5 2021-10-31 28.4 31.3
WW21-3849 NS1 2021-10-25 3 3.2
WW21-3850 NS2 2021-10-25 9.3 11.1
WW21-3851 NS3 2021-10-25 3 4.9
WW21-3852 NS1 2021-10-27 8.2 7.5
WW21-3853 NS2 2021-10-27 6.5 3.3
WW21-3854 NS3 2021-10-27 7.4 1
WW21-3861 NU1 2021-10-25 1 1
WW21-3862 NU1 2021-10-27 1 1
WW21-3867 ON1 2021-10-31 5.2 12.7
WW21-3868 ON2 2021-10-31 6.4 5.7
WW21-3869 ON3 2021-10-31 8.7 3.5
WW21-3870 ON4 2021-10-31 7 1
WW21-3883 NU2 2021-11-01 1 1
WW21-3884 NU2 2021-11-03 1 1
WW21-3887 NL11 2021-11-04 3 1
WW21-3889 NL10 2021-11-03 1 1
WW21-3896 NL6 2021-11-01 1 1
WW21-3898 NU1 2021-11-01 3 1
WW21-3904 ON1 2021-11-02 34.1 29.5
WW21-3905 ON2 2021-11-02 8.2 1
WW21-3906 ON3 2021-11-02 7.1 4
WW21-3907 ON4 2021-11-02 3 1
WW21-3912 NU1 2021-10-29 1 1
WW21-3921 NT3 2021-10-28 21.9 22.3
WW21-3922 NT3 2021-11-02 31.8 24.4
WW21-3927 AB1 2021-10-28 24.6 19.2
WW21-3928 AB1 2021-10-31 36.1 27.5
WW21-3929 AB1 2021-11-04 38 26.3
WW21-3930 AB1 2021-11-07 20.8 23
WW21-3931 QC1 2021-11-03 7.5 11.8
WW21-3932 QC2 2021-11-03 9.8 12
WW21-3933 QC1 2021-11-06 11.4 14.3
WW21-3948 NU1 2021-11-03 1 1
WW21-3949 NU1 2021-11-05 1 1
WW21-3954 BC1 2021-11-04 11.3 9.7
WW21-3955 BC2 2021-11-04 3 1
WW21-3956 BC3 2021-11-04 3.9 1
WW21-3957 BC4 2021-11-04 6.6 3
WW21-3958 BC5 2021-11-04 8.6 7.1
WW21-3959 BC1 2021-11-07 7.6 14
WW21-3960 BC2 2021-11-07 3 1
WW21-3961 BC3 2021-11-07 6.8 4.9
WW21-3962 BC4 2021-11-07 8.6 4.7
WW21-3963 BC5 2021-11-07 10 5
WW21-3964 NS1 2021-11-01 3 1
WW21-3965 NS2 2021-11-01 4 1
WW21-3966 NS3 2021-11-01 33.5 1
WW21-3967 NS1 2021-11-03 3.9 3.2
WW21-3968 NS2 2021-11-03 8.4 12.6
WW21-3969 NS3 2021-11-03 10.4 1
WW21-3970 NL11 2021-11-08 3 1
WW21-3985 ON1 2021-11-07 7.1 9.6
WW21-3986 ON2 2021-11-07 5.3 3
WW21-3987 ON3 2021-11-07 4.8 3
WW21-3988 ON4 2021-11-07 3 3
WW21-3996 NL11 2021-11-10 3 1
WW21-4001 NL10 2021-11-10 1 1
WW21-4006 NU1 2021-11-08 1 1
WW21-4007 NU2 2021-11-08 1 1
WW21-4008 NU2 2021-11-10 1 1
WW21-4013 NL6 2021-11-08 1 1
WW21-4047 QC1 2021-11-10 6.1 15.6
WW21-4048 QC2 2021-11-10 8.6 10.7
WW21-4049 QC1 2021-11-13 9.1 9.4
WW21-4050 QC2 2021-11-13 7.8 8.9
WW21-4055 BC1 2021-11-11 8.6 7.9
WW21-4056 BC2 2021-11-11 4 3.1
WW21-4057 BC3 2021-11-11 6.7 3.6
WW21-4058 BC5 2021-11-11 10 6
WW21-4059 BC1 2021-11-14 5.6 1
WW21-4060 BC2 2021-11-14 3 1
WW21-4061 BC3 2021-11-14 6 1
WW21-4062 BC4 2021-11-14 3 1
WW21-4063 BC5 2021-11-14 7.7 3
WW21-4064 AB1 2021-11-11 20.8 23.9
WW21-4065 AB1 2021-11-14 31.3 25.7
WW21-4066 ON1 2021-11-09 9.3 11.4
WW21-4067 ON2 2021-11-09 16.4 16.4
WW21-4068 ON3 2021-11-09 34.7 28.9
WW21-4069 ON4 2021-11-09 8.1 1
WW21-4076 NU1 2021-11-10 1 1
WW21-4077 NU1 2021-11-12 3 1
WW21-4084 NT3 2021-11-08 3.9 3
WW21-4087 NT4 2021-11-01 3 1
WW21-4088 NT5 2021-11-04 6.6 4.3
WW21-4089 NT6 2021-11-04 6.5 1
WW21-4090 NT5 2021-11-08 8 3
WW21-4091 NT6 2021-11-08 6.7 1
WW21-4092 NT5 2021-11-09 4 3.8
WW21-4093 NT6 2021-11-09 2.8 1
WW21-4094 NT5 2021-11-10 4.7 3
WW21-4095 NT6 2021-11-10 3 1
WW21-4096 NT5 2021-11-12 3 1
WW21-4097 NT6 2021-11-12 1 1
WW21-4104 NS1 2021-11-08 3 3
WW21-4105 NS2 2021-11-08 3.6 3
WW21-4106 NS3 2021-11-08 3 1
WW21-4107 NS1 2021-11-10 4.8 3.3
WW21-4108 NS2 2021-11-10 11 1
WW21-4109 NS3 2021-11-10 6.3 3
WW21-4110 ON1 2021-11-14 5.7 7.3
WW21-4111 ON2 2021-11-14 8.2 3
WW21-4112 ON3 2021-11-14 4.2 5.1
WW21-4113 ON4 2021-11-14 4.3 4.1
WW21-4120 NU2 2021-11-15 1 1
WW21-4121 NU2 2021-11-17 1 1
WW21-4122 NL11 2021-11-15 2.8 1
WW21-4126 NL6 2021-11-15 3 1
WW21-4132 ON1 2021-11-16 3.8 3.4
WW21-4133 ON2 2021-11-16 18.5 6.4
WW21-4134 ON3 2021-11-16 5.3 5.1
WW21-4135 ON4 2021-11-16 2.9 4
WW21-4136 NL11 2021-11-18 1 1
WW21-4140 NL10 2021-11-17 1 1
WW21-4148 QC1 2021-11-17 8.1 7.8
WW21-4149 QC2 2021-11-17 9 3.6
WW21-4150 QC1 2021-11-20 8.8 4.8
WW21-4151 QC2 2021-11-20 5.7 3.3
WW21-4166 NT5 2021-11-16 3 5.9
WW21-4167 NT6 2021-11-16 4.1 1
WW21-4179 AB1 2021-11-18 20.8 21.8
WW21-4180 AB1 2021-11-21 24.9 17.9
WW21-4187 NL11 2021-11-22 3 1
WW21-4190 NU1 2021-11-15 1 70.3
WW21-4191 NU1 2021-11-17 1 1
WW21-4197 BC1 2021-11-18 10.9 4.5
WW21-4198 BC2 2021-11-18 4.2 3
WW21-4199 BC3 2021-11-18 4.6 3
WW21-4200 BC4 2021-11-18 23.8 42.6
WW21-4201 BC5 2021-11-18 11.2 8.7
WW21-4202 BC1 2021-11-21 7.8 9.8
WW21-4203 BC2 2021-11-21 4.4 12.2
WW21-4204 BC3 2021-11-21 6.5 3
WW21-4205 BC4 2021-11-21 8.5 4.8
WW21-4206 BC5 2021-11-21 8.3 4.3
WW21-4207 NS1 2021-11-15 3 1
WW21-4208 NS2 2021-11-15 9.7 9
WW21-4209 NS3 2021-11-15 3 1
WW21-4210 NS1 2021-11-17 1 1
WW21-4211 NS2 2021-11-17 3 1
WW21-4212 NS3 2021-11-17 9.3 1
WW21-4213 ON1 2021-11-21 6.9 3
WW21-4214 ON2 2021-11-21 8.4 3.3
WW21-4215 ON3 2021-11-21 9.9 7.3
WW21-4216 ON4 2021-11-21 6.7 3
WW21-4224 NL6 2021-11-22 3007.6 194.7
WW21-4229 NU2 2021-11-22 1 1
WW21-4230 NU2 2021-11-24 1 1
WW21-4233 NU1 2021-11-19 1 1
WW21-4234 ON1 2021-11-23 6.1 3
WW21-4235 ON2 2021-11-23 14.4 12.9
WW21-4236 ON3 2021-11-23 13.5 15.9
WW21-4237 ON4 2021-11-23 7.6 11.7
WW21-4242 NU1 2021-11-22 3 1
WW21-4256 NL11 2021-11-25 9.8 3
WW21-4261 NL10 2021-11-24 1 1
WW21-4272 BC1 2021-11-25 10 3
WW21-4273 BC2 2021-11-25 3 1
WW21-4274 BC3 2021-11-25 7.2 3
WW21-4275 BC4 2021-11-25 7.1 3.7
WW21-4276 BC5 2021-11-25 6.8 1
WW21-4277 BC1 2021-11-28 3 1
WW21-4278 BC2 2021-11-28 3 1
WW21-4279 BC3 2021-11-28 3 1
WW21-4280 BC4 2021-11-28 6.2 4.3
WW21-4281 BC5 2021-11-28 4.9 5.4
WW21-4282 AB1 2021-11-25 14.3 5.9
WW21-4283 AB1 2021-11-28 19.8 7.7
WW21-4290 NL11 2021-11-29 3 1
WW21-4299 QC1 2021-11-24 9.8 7.2
WW21-4300 QC2 2021-11-24 8.1 3
WW21-4301 QC1 2021-11-27 9.9 3
WW21-4302 QC2 2021-11-27 6.6 3
WW21-4303 ON1 2021-11-28 10.7 1
WW21-4304 ON2 2021-11-28 14.2 4
WW21-4305 ON3 2021-11-28 89.8 60.6
WW21-4306 ON4 2021-11-28 7.1 3
WW21-4313 NS1 2021-11-22 22.8 1
WW21-4314 NS2 2021-11-22 12.6 1
WW21-4315 NS3 2021-11-22 5.3 1
WW21-4316 NS1 2021-11-24 5.7 1
WW21-4317 NS2 2021-11-24 12.4 1
WW21-4318 NS3 2021-11-24 14.2 1
WW21-4325 NL6 2021-11-29 1366.2 85.2
WW21-4338 NU1 2021-11-24 1 1
WW21-4339 NU1 2021-11-26 1 1
WW21-4340 NU1 2021-11-29 1 1
WW21-4342 NU2 2021-11-29 1 1
WW21-4350 ON1 2021-11-30 7.2 3
WW21-4351 ON3 2021-11-30 12.8 7.4
WW21-4352 ON4 2021-11-30 6.2 1
WW21-4364 QC1 2021-12-01 20.8 8.4
WW21-4365 QC2 2021-12-01 25.3 14.6
WW21-4402 NS1 2021-11-29 5.1 1
WW21-4403 NS2 2021-11-29 6.4 1
WW21-4404 NS3 2021-11-29 6.1 1
WW21-4405 NS1 2021-12-01 5.6 1
WW21-4406 NS2 2021-12-01 3 1
WW21-4407 NS3 2021-12-01 3 1
WW21-4639 NT5 2021-11-22 3 3
WW21-4640 NT5 2021-11-23 3 1

The more sparsely populated regions investigated in this study showed less consistent detection of D377Y, with detection in 50% of remote sites in Newfoundland and Labrador (n=6/12) during at least one time point throughout the sampling period. In Newfoundland and Labrador, D377Y was not detected in 4/6 sites prior to the last week of October 2021, whereas the remaining two sites had detection in July and September.

In the northern Territorial regions, Delta signal was detected in all six Northwest Territories (NWT) sites and both Nunavut (NU) sites during at least one time point. The NU1 variant had sporadic low-level detection in September, while D377Y was detected in NU2 in August to mid-September, peaking with a strong signal on September 8. The NT1 variant was sampled only in November, with high levels of detection throughout the month. Delta signal was first detected between August 12–19 in four of the remaining five NWT sites, and on September 20 for the final site. Four NWT sites (NT1,NT4–NT6) were not sampled during the month of October.

Discussion

This study describes the development of RT-qPCR assays to detect the N gene D377Y mutation associated with the SARS-CoV-2 Delta variant. The LODs of this assay were near the theoretical limit of RT-qPCR and sufficient for sensitive detection in wastewater, where SARS-CoV-2 RNA concentrations can be very low. The robustness and sensitivity of the V component of the assay allows for trending analysis, and where appropriate, early warning detection in communities and for monitoring the decline of the Delta wave.

The D377Y V assay is valuable for tracking the spread of the Delta variant in wastewater as it was used to monitor the spread of the Delta variant in eight major cities and 26 towns and rural locations across Canada over a four-month period. The Delta variant was detected in wastewater from all major Canadian cities, with a rapid increase in signal shortly following onset of detection, indicating rapid spread of Delta and displacement of other variants. Delta signal was also observed in approximately half of rural locations in Southern Canada, and all locations in Northern Canada. These data demonstrate the utility of this assay for tracking the spread of the SARS-CoV-2 Delta variant. These one-step RT-qPCR assays can be easily integrated into currently used wastewater surveillance programs to aid in SARS-CoV-2 surveillance.

Limitations

Assay limitations include the loss in sensitivity in the presence of the V allele, which limits the interpretation of the WT component of the assay during the onset of a Delta wave, where high levels of variant genomic material will attenuate the WT signal. This is consistent with previous studies that found a similar level of cross-reactivity between variant and WT assays Footnote 13 Footnote 22. In wastewater samples, this delayed cross-reactivity is negligible, as the SARS-CoV-2 concentration is very low. Other limitations of this assay include: 1) inconsistent detection when RNA concentration in samples approaches the LOD of the assay or 2) the presence of inhibitors found in wastewater. Limitations of wastewater-based surveillance include testing being limited to populations present within the wastewater catchment area, variations in viral shedding between SARS-CoV-2 variants and infected individuals, and variations in wastewater composition due to weather or industrial events.

The Delta variant of SARS-CoV-2 is defined by 27 mutations, which are commonly detected by whole genome sequencing Footnote 3 Footnote 23 Footnote 24 Footnote 25. While detection of one mutation such as D377Y is not determinative of Delta variant presence, it is highly indicative as the N gene D377Y mutation is found very rarely in non-Delta strains Footnote 26.

Conclusion

Surveillance using RT-qPCR is a rapid and cost-effective method of screening for SARS-CoV-2 variants in both wastewater and clinical specimens. These assays provide a complement to SARS-CoV-2 variant detection assays as previously described Footnote 14 for surveillance of SARS-CoV-2 variants in wastewater. Wastewater-based surveillance is a valuable tool for tracking the spread of SARS-CoV-2 variants on a population level in regions where clinical testing is limited. The relative fraction of the Delta variant measured in wastewater using the assay developed in this work was communicated to public health decision-makers by weekly reporting across a network of surveillance sites throughout Canada. To our knowledge, these data were used as a complimentary public health intelligence stream and not directly actioned. Thus, over the course of the pandemic, this was principally the use for wastewater surveillance data amongst infectious control and public health leadership; likely because of a gap in trust arising from a lack of precedent and unfamiliarity with the data, in addition to the public scrutiny and pressure associated with pandemic. We hope that this work and the work of others will establish a base of use cases that will improve the action-ability of wastewater surveillance. A conservative use case could be to maintain wide-scale infectious control measures based on wastewater surveillance data. While more than a year has passed since the Delta wave, the relevance of the assay described here remains as sub-lineages of the Delta VOC has been observed in wild populations of white-tailed deer Footnote 27 Footnote 28 and this work could contribute to the monitoring of the expanding host range of this virus. With the high number of asymptomatic COVID-19 cases and limited testing capacity worldwide, augmentation of surveillance capabilities by monitoring spread of SARS-CoV-2 variants in wastewater can aid in public health efforts.

Authors' statement

SWP — Conceptualization, methodology, investigation, validation, writing, visualization

JD — Methodology, investigation, validation

CD — Methodology, investigation, validation

AN — Conceptualization, resources, project administration

MRM — Conceptualization, supervision, project administration

CSM — Conceptualization, writing, supervision, funding acquisition, project administration

Competing interests

None.

Acknowledgments

We would like to thank Stacie Langner, Umar Mohammed, Graham Cox, Quinn Wonitowy, Nestor Medina, Nataliya Zharska, Ravinder Lidder, and Dave Spreitzer for their technical assistance and support. Chrystal Landgraff and Gary von Domselaar for providing genomic information on circulating SARS-CoV-2 in Canada. Cadham Provincial Laboratory virus detection staff and the communities and municipalities for providing wastewater samples for analysis.

Funding

This work was supported by internal funds from the Public Health Agency of Canada.

References

Footnote 1

Coronaviridae Study Group of the International Committee on Taxonomy of Viruses. The species Severe acute respiratory syndrome-related coronavirus: classifying 2019-nCoV and naming it SARS-CoV-2. Nat Microbiol 2020;5(4):536–44. https://doi.org/10.1038/s41564-020-0695-z

Return to footnote 1 referrer

Footnote 2

Naveca F, Nascimento V, Souza V, Corado A, Nascimento F, Silva G, Costa A, Duarte D, Pessoa K, Goncalves L, Brandao MJ, Jesus M, Fernandes C, Pinto R, Silva M, Mattos T, Wallau GL, Siqueira MM, Resende PC, Delatorre E, Graf T. Phylogenetic relationship of SARS-CoV-2 sequences from Amazonas with emerging Brazilian variants harboring mutations E484K and N501Y in the Spike protein. https://virological.org/t/phylogenetic-relationship-of-sars-cov-2-sequences-from-amazonas-with-emerging-brazilian-variants-harboring-mutations-e484k-and-n501y-in-the-spike-protein/585

Return to footnote 2 referrer

Footnote 3

Tegally H, Wilkinson E, Giovanetti M, Iranzadeh A, Fonseca V, Giandhari J, Doolabh D, Pillay S, San EJ, Msomi N, Mlisana K, von Gottberg A, Walaza S, Allam M, Ismail A, Mohale T, Glass AJ, Engelbrecht S, Van Zyl G, Preiser W, Petruccione F, Sigal A, Hardie D, Marais G, Hsiao NY, Korsman S, Davies MA, Tyers L, Mudau I, York D, Maslo C, Goedhals D, Abrahams S, Laguda-Akingba O, Alisoltani-Dehkordi A, Godzik A, Wibmer CK, Sewell BT, Lourenço J, Alcantara LC, Kosakovsky Pond SL, Weaver S, Martin D, Lessells RJ, Bhiman JN, Williamson C, de Oliveira T. Detection of a SARS-CoV-2 variant of concern in South Africa. Nature 2021;592(7854):438–43. https://doi.org/10.1038/s41586-021-03402-9

Return to footnote 3 referrer

Footnote 4

Volz E, Mishra S, Chand M, Barrett JC, Johnson R, Geidelberg L, Hinsley WR, Laydon DJ, Dabrera G, O’Toole Á, Amato R, Ragonnet-Cronin M, Harrison I, Jackson B, Ariani CV, Boyd O, Loman NJ, McCrone JT, Gonçalves S, Jorgensen D, Myers R, Hill V, Jackson DK, Gaythorpe K, Groves N, Sillitoe J, Kwiatkowski DP, Flaxman S, Ratmann O, Bhatt S, Hopkins S, Gandy A, Rambaut A, Ferguson NM; COVID-19 Genomics UK (COG-UK) consortium. Assessing transmissibility of SARS-CoV-2 lineage B.1.1.7 in England. Nature 2021;593(7858):266–9. https://doi.org/10.1038/s41586-021-03470-x

Return to footnote 4 referrer

Footnote 5

World Health Organization Tracking SARS-CoV-2 Variants. Geneva (CH): WHO; 2023. https://www.who.int/en/activities/tracking-SARS-CoV-2-variants/

Return to footnote 5 referrer

Footnote 6

Choi JY, Smith DM. SARS-CoV-2 Variants of Concern. Yonsei Med J 2021;62(11):961–8. https://doi.org/10.3349/ymj.2021.62.11.961

Return to footnote 6 referrer

Footnote 7

Fisman DN, Tuite AR. Evaluation of the relative virulence of novel SARS-CoV-2 variants: a retrospective cohort study in Ontario, Canada. CMAJ 2021;193(42):E1619–25. https://doi.org/10.1503/cmaj.211248

Return to footnote 7 referrer

Footnote 8

Tao K, Tzou PL, Nouhin J, Gupta RK, de Oliveira T, Kosakovsky Pond SL, Fera D, Shafer RW. The biological and clinical significance of emerging SARS-CoV-2 variants. Nat Rev Genet 2021;22(12):757–73. https://doi.org/10.1038/s41576-021-00408-x

Return to footnote 8 referrer

Footnote 9

Ahmed W, Angel N, Edson J, Bibby K, Bivins A, O’Brien JW, Choi PM, Kitajima M, Simpson SL, Li J, Tscharke B, Verhagen R, Smith WJ, Zaugg J, Dierens L, Hugenholtz P, Thomas KV, Mueller JF. First confirmed detection of SARS-CoV-2 in untreated wastewater in Australia: A proof of concept for the wastewater surveillance of COVID-19 in the community. Sci Total Environ 2020;728:138764. https://doi.org/10.1016/j.scitotenv.2020.138764

Return to footnote 9 referrer

Footnote 10

Daigle J, Racher K, Hazenberg J, Yeoman A, Hannah H, Duong D, Mohammed U, Spreitzer D, Gregorchuk BS, Head BM, Meyers AF, Sandstrom PA, Nichani A, Brooks JI, Mulvey MR, Mangat CS, Becker MG. A sensitive and rapid wastewater test for SARS-COV-2 and its use for the early detection of a cluster of cases in a remote community. Appl Environ Microbiol 2022;88(5):e0174021. https://doi.org/10.1128/aem.01740-21

Return to footnote 10 referrer

Footnote 11

Kumar M, Patel AK, Shah AV, Raval J, Rajpara N, Joshi M, Joshi CG. First proof of the capability of wastewater surveillance for COVID-19 in India through detection of genetic material of SARS-CoV-2. Sci Total Environ 2020;746:141326. https://doi.org/10.1016/j.scitotenv.2020.141326

Return to footnote 11 referrer

Footnote 12

Westhaus S, Weber FA, Schiwy S, Linnemann V, Brinkmann M, Widera M, Greve C, Janke A, Hollert H, Wintgens T, Ciesek S. Detection of SARS-CoV-2 in raw and treated wastewater in Germany - Suitability for COVID-19 surveillance and potential transmission risks. Sci Total Environ 2021;751:141750. https://doi.org/10.1016/j.scitotenv.2020.141750

Return to footnote 12 referrer

Footnote 13

Graber TE, Mercier É, Bhatnagar K, Fuzzen M, D’Aoust PM, Hoang HD, Tian X, Towhid ST, Plaza-Diaz J, Eid W, Alain T, Butler A, Goodridge L, Servos M, Delatolla R. Near real-time determination of B.1.1.7 in proportion to total SARS-CoV-2 viral load in wastewater using an allele-specific primer extension PCR strategy. Water Res 2021;205:117681. https://doi.org/10.1016/j.watres.2021.117681

Return to footnote 13 referrer

Footnote 14

Peterson SW, Lidder R, Daigle J, Wonitowy Q, Dueck C, Nagasawa A, Mulvey MR, Mangat CS. RT-qPCR detection of SARS-CoV-2 mutations S 69-70 del, S N501Y and N D3L associated with variants of concern in Canadian wastewater samples. Sci Total Environ 2022;810:151283. https://doi.org/10.1016/j.scitotenv.2021.151283

Return to footnote 14 referrer

Footnote 15

Yaniv K, Ozer E, Shagan M, Lakkakula S, Plotkin N, Bhandarkar NS, Kushmaro A. Direct RT-qPCR assay for SARS-CoV-2 variants of concern (Alpha, B.1.1.7 and Beta, B.1.351) detection and quantification in wastewater. Environ Res 2021;201:111653. https://doi.org/10.1016/j.envres.2021.111653

Return to footnote 15 referrer

Footnote 16

Corchis-Scott R, Geng Q, Seth R, Ray R, Beg M, Biswas N, Charron L, Drouillard KD, D’Souza R, Heath DD, Houser C, Lawal F, McGinlay J, Menard SL, Porter LA, Rawlings D, Scholl ML, Siu KW, Tong Y, Weisener CG, Wilhelm SW, McKay RM. Averting an Outbreak of SARS-CoV-2 in a University Residence Hall through Wastewater Surveillance. Microbiol Spectr 2021;9(2):e0079221. https://doi.org/10.1128/Spectrum.00792-21

Return to footnote 16 referrer

Footnote 17

Statistics Canada. Canadian Wastewater Survey (CWS). Ottawa, ON: StatCan; 2022. https://www.statcan.gc.ca/en/survey/business/5280

Return to footnote 17 referrer

Footnote 18

Global Initiative on Sharing Avian Influenza Data. http://doi.org/10.17616/R3Q59F

Return to footnote 18 referrer

Footnote 19

Untergasser A, Cutcutache I, Koressaar T, Ye J, Faircloth BC, Remm M, Rozen SG. Primer3--new capabilities and interfaces. Nucleic Acids Res 2012;40(15):e115. https://doi.org/10.1093/nar/gks596

Return to footnote 19 referrer

Footnote 20

Lu X, Wang L, Sakthivel SK, Whitaker B, Murray J, Kamili S, Lynch B, Malapati L, Burke SA, Harcourt J, Tamin A, Thornburg NJ, Villanueva JM, Lindstrom S. CDC real-time reverse transcription PCR panel for detection of severe acute respiratory syndrome coronavirus 2. Emerg Infect Dis 2020;26(8):1654–65. https://doi.org/10.3201/eid2608.201246

Return to footnote 20 referrer

Footnote 21

Wickham H, Averick M, Bryan J, Chang W, D’Agostino McGowan L, Francois R, Grolemond G, Hayes A, Henry L, Hester J, Kuhn M, Pederson TL, Miller E, Bache SM, Muller K, Ooms J, Robinson D, Seidel DP, Spinu V, Takahashi K, Vaughan D, Wilke C, Woo K, Yutani H. Welcome to the Tidyverse. J Open Source Softw 2019;4(43):1686. https://doi.org/10.21105/joss.01686

Return to footnote 21 referrer

Footnote 22

Lee WL, Gu X, Armas F, Wu F, Chandra F, Chen H, Xiao A, Leifels M, Chua FJD, Kwok GWC, Tay JYR, Lim CYJ, Thompson J, Alm EJ. Quantitative detection of SARS-CoV-2 Omicron BA.1 and BA.2 variants in wastewater by allele-specific RT-qPCR. medRxiv 2021.12.21.21268077. https://doi.org/10.1101/2021.12.21.21268077

Return to footnote 22 referrer

Footnote 23

Crits-Christoph A, Kantor RS, Olm MR, Whitney ON, Al-Shayeb B, Lou YC, Flamholz A, Kennedy LC, Greenwald H, Hinkle A, Hetzel J, Spitzer S, Koble J, Tan A, Hyde F, Schroth G, Kuersten S, Banfield JF, Nelson KL. Genome Sequencing of Sewage Detects Regionally Prevalent SARS-CoV-2 Variants. MBio 2021;12(1):e02703–20. https://doi.org/10.1128/mBio.02703-20

Return to footnote 23 referrer

Footnote 24

Fontenele RS, Kraberger S, Hadfield J, Driver EM, Bowes D, Holland LA, Faleye TO, Adhikari S, Kumar R, Inchausti R, Holmes WK, Deitrick S, Brown P, Duty D, Smith T, Bhatnagar A, Yeager RA 2nd, Holm RH, von Reitzenstein NH, Wheeler E, Dixon K, Constantine T, Wilson MA, Lim ES, Jiang X, Halden RU, Scotch M, Varsani A. High-throughput sequencing of SARS-CoV-2 in wastewater provides insights into circulating variants. Water Res 2021;205:117710. https://doi.org/10.1016/j.watres.2021.117710

Return to footnote 24 referrer

Footnote 25

Hodcroft E. CoVariants: Variant 21A (Delta). https://covariants.org/variants/21A.Delta

Return to footnote 25 referrer

Footnote 26

Nextstrain. Genomic Epidemiology of SARS-CoV-2 with subsampling focused globally over the past 6 months. https://nextstrain.org/ncov/gisaid/global/6m?c=gt-N_377

Return to footnote 26 referrer

Footnote 27

McBride D, Garushyants S, Franks J, Magee A, Overend S, Huey D, Williams A, Faith S, Kandeil A, Trifkovic S, Miller L, Jeevan T, Patel A, Nolting J, Tonkovich M, Genders JT, Montoney A, Kasnyik K, Linder T, Bevins S, Lenoch J, Chandler J, DeLiberto T, Koonin E, Suchard M, Lemey P, Webby R, Nelson M, Bowman A. Accelerated evolution of SARS-CoV-2 in free-ranging white-tailed deer. Res Sq 2023;rs.3.rs-2574993. 10.21203/rs.3.rs-2574993/v1

Return to footnote 27 referrer

Footnote 28

Caserta LC, Martins M, Butt SL, Hollingshead NA, Covaleda LM, Ahmed S, Everts MR, Schuler KL, Diel DG. White-tailed deer (Odocoileus virginianus) may serve as a wildlife reservoir for nearly extinct SARS-CoV-2 variants of concern. Proc Natl Acad Sci USA 2023;120(6):e2215067120. https://doi.org/10.1073/pnas.2215067120

Return to footnote 28 referrer

Appendix

Table A1: Positive control gBlock sequences for the SARS-CoV-2 Delta variant real-time quantitative reverse
transcription polymerase chain reaction assays
Region Allele Sequence
N D377Y WT AAAGATCCAAATTTCAAAGATCAAGTCATTTTGCTGAATAAGCATATTGACGCATACAAAACATTCCCACCAACAGA
GCCTAAAAAGGACAAAAAGAAGAAGGCTGATGAAACTCAAGCCTTACCGCAGAGACAGAAGAAACAGCAAACTGTGAC
TCTTCTTCCTGCTGCAGATTTGGATGATTTCTCCAAACAATTGCAA
Variant AAAGATCCAAATTTCAAAGATCAAGTCATTTTGCTGAATAAGCATATTGACGCATACAAAACATTCCCACCAACAGA
GCCTAAAAAGGACAAAAAGAAGAAGGCTTATGAAACTCAAGCCTTACCGCAGAGACAGAAGAAACAGCAAACTGT
GACTCTTCTTCCTGCTGCAGATTTGGATGATTTCTCCAAACAATTGCAA
Table A1 abbreviations

Abbreviations: SARS-CoV-2, severe acute respiratory syndrome coronavirus 2; WT, wild-type


Table A2: Location and number of samples tested from wastewater treatment plants and lift stations across Canada
Site code Region Sampling date range Date of first detection Date of peak signal Number of samples
AB1 Edmonton, AB 2021-07-08 to 2021-11-28 2021-07-18 2021-09-05 40
BC1 Vancouver, BC 2021-07-15 to 2021-11-28 2021-07-22 2021-09-12 37
BC2 Vancouver, BC 2021-07-15 to 2021-11-28 2021-07-22 2021-09-12 37
BC3 Vancouver, BC 2021-07-15 to 2021-11-28 2021-07-22 2021-09-12 38
BC4 Vancouver, BC 2021-07-15 to 2021-11-28 2021-07-22 2021-07-22 37
BC5 Vancouver, BC 2021-07-15 to 2021-11-28 2021-07-22 2021-09-05 38
NL1 Newfoundland and Labrador 2021-10-04 to 2021-11-29 Not detected Not detected 9
NL2 Newfoundland and Labrador 2021-10-04 to 2021-11-29 2021-11-29 2021-11-29 9
NL3 Newfoundland and Labrador 2021-10-04 to 2021-11-29 2021-11-16 2021-11-16 8
NL4 Newfoundland and Labrador 2021-07-19 to 2021-11-24 Not detected Not detected 14
NL5 Newfoundland and Labrador 2021-10-06 to 2021-11-17 Not detected Not detected 6
NL6 Newfoundland and Labrador 2021-10-04 to 2021-11-29 2021-11-22 2021-11-22 9
NL7 Newfoundland and Labrador 2021-07-14 to 2021-11-24 2021-07-21 2021-07-21 20
NL8 Newfoundland and Labrador 2021-09-16 to 2021-11-29 Not detected Not detected 8
NL9 Newfoundland and Labrador 2021-10-14 to 2021-11-30 Not detected Not detected 7
NL10 Newfoundland and Labrador 2021-07-22 to 2021-11-24 2021-08-30 2021-08-30 20
NL11 Newfoundland and Labrador 2021-07-13 to 2021-11-29 2021-09-02 2021-10-07 39
NL12 Newfoundland and Labrador 2021-10-04 to 2021-11-30 2021-10-25 2021-10-25 9
NL13 Newfoundland and Labrador 2021-10-14 to 2021-11-30 Not detected Not detected 7
NS1 Halifax, Nova Scotia 2021-07-05 to 2021-12-01 2021-08-23 2021-10-18 42
NS2 Halifax, Nova Scotia 2021-07-05 to 2021-12-01 2021-08-04 2021-09-06 42
NS3 Halifax, Nova Scotia 2021-07-05 to 2021-12-01 2021-08-30 2021-10-13 42
NT1 Northwest Territories 2021-11-03 to 2021-11-24 2021-11-04 2021-11-10 15
NT2 Northwest Territories 2021-10-19 to 2021-11-17 2021-09-20 2021-09-20 11
NT3 Northwest Territories 2021-08-16 to 2021-11-08 2021-08-16 2021-09-20 16
NT4 Northwest Territories 2021-08-16 to 2021-11-01 2021-08-19 2021-08-30 12
NT5 Northwest Territories 2021-06-30 to 2021-11-23 2021-08-12 2021-09-23 53
NT6 Northwest Territories 2021-08-19 to 2021-11-16 2021-08-19 2021-08-26 23
NU1 Nunavut 2021-07-14 to 2021-11-29 2021-09-10 2021-11-15 54
NU2 Nunavut 2021-07-22 to 2021-11-29 2021-08-17 2021-09-08 56
ON1 Toronto, ON 2021-07-11 to 2021-11-30 2021-07-11 2021-08-29 38
ON2 Toronto, ON 2021-07-11 to 2021-11-28 2021-07-18 2021-07-27 37
ON3 Toronto, ON 2021-07-11 to 2021-11-30 2021-07-18 2021-08-15 37
ON4 Toronto, ON 2021-07-11 to 2021-11-30 2021-08-03 2021-09-14 38
QC1 Montréal, QC 2021-07-14 to 2021-12-01 2021-07-21 2021-09-08 36
QC2 Montréal, QC 2021-07-17 to 2021-12-01 2021-08-11 2021-10-16 36
Tableau A2 abbreviations

Abbreviations: AB, Alberta; BC, British Columbia; NL, Newfoundland and Labrador; NS, Nova Scotia; NT, Northwest Territories; NU, Nunavut; ON, Ontario; QC, Québec

Page details

2023-06-01