Detection of SARS-CoV-2 Delta variant in Canadian wastewater

Abstract

Background: Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) variants of concern are associated with increased infectivity, severity, and mortality of coronavirus disease 2019 (COVID-19) and have been increasingly detected in clinical and wastewater surveillance in Canada and internationally. In this study, we present a real-time quantitative reverse transcription polymerase chain reaction (RT-qPCR) assay for detection of the N gene D377Y mutation associated with the SARS-CoV-2 Delta variant in wastewater.

Methods: Wastewater samples (n=980) were collected from six cities and 17 rural communities across Canada from July to November 2021 and screened for the D377Y mutation.

Results: The Delta variant was detected in all major Canadian cities and northern remote regions, and half of the southern rural communities. The sensitivity and specificity of this assay were sufficient for detection and quantitation of the Delta variant in wastewater to aid in rapid population-level screening and surveillance.

Conclusion: This study demonstrates a novel cost-effective RT-qPCR assay for tracking the spread of the SARS-CoV-2 Delta variant. This rapid assay can be easily integrated into current wastewater surveillance programs to aid in population-level variant tracking.

Introduction

The severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) pandemic began in Wuhan, China in late 2019 before becoming a worldwide pandemic in 2020. Beginning in September 2020, variants of concern (VOC) began to emerge which had mutations leading to increased viral transmission rates, increased virulence, or the ability to escape existing vaccines ^{Footnote 1 Footnote 2 Footnote 3 Footnote 4}. On May 11, 2021, the World Health Organization declared the Delta variant (B.1.617.2) to be a VOC ^{Footnote 5}. The Delta variant has been shown to be both more transmissible and more virulent than the wild-type (WT) (Wuhan) strain ^{Footnote 6 Footnote 7 Footnote 8}.

Wastewater-based epidemiology (WBE) has proven to be a powerful tool for tracking the spread of SARS-CoV-2 on a population level, and recently has become instrumental in monitoring the dissemination of VOC across Canada and throughout the world ^{Footnote 9 Footnote 10 Footnote 11 Footnote 12}. The real-time quantitative reverse transcription polymerase chain reaction (RT-qPCR)-based assays have previously been developed to identify mutations associated with emerging VOC including Alpha (Sdel69-70, ND3L), Beta (Sdel241, N501Y) and Gamma (N501Y) ^{Footnote 13 Footnote 14 Footnote 15}. Early detection of VOC can potentially lead to improved public health responses, such as increased sequencing of clinical isolates, enhanced surveillance and enhanced public health measures. Monitoring relative amounts of SARS-CoV-2 variants over time can be useful for monitoring trends in viral transmission and potentially assessing the effectiveness of public health interventions ^{Footnote 16}.

In this report, we describe a novel RT-qPCR assay for detection of the N gene D377Y allele—associated with the Delta variant—in wastewater. We applied this assay to wastewater samples collected from 36 sampling locations drawn from 23 Canadian cities and towns, both remote and urban, to monitor the dissemination of the Delta variant throughout the country. This population-level surveillance approach could be instrumental for monitoring changes in VOC prevalence and effects of public health interventions for reduction of viral spread within health regions.

Methods

Sample collection and nucleic acid extraction

Wastewater was collected between June 30 and December 1, 2021, from 16 urban wastewater treatment plants (WWTP) from six cities along with 20 WWTP and lift stations from 17 towns and rural locations in Canada. Fifteen of the WWTP from five cities were sampled as part of Statistics Canada's Canadian Wastewater Survey ^{Footnote 17}. A 24-hour composite sample was collected three times per week at each treatment facility and shipped to the National Microbiology Laboratory at 4°C. The samples were stored at 4°C for up to 24 hours until processed.

A 300 ml sample of primary post-grit influent or raw wastewater was mixed by inversion, then a 30 mL aliquot was drawn and processed as previously described ^{Footnote 14}. RNA was extracted using the MagNA Pure 96 DNA and Viral NA Large Volume Kit (Roche Diagnostics, Laval, Québec) using the Plasma External Lysis 4.0 protocol as per manufacturer instructions.

Delta variant of concern assay design

An assay was developed to detect the D377Y mutation consisting of a G->T in the N gene (G29406T) due to relative rarity in the general Canadian population of SARS-CoV-2 genomes, and relative exclusivity within the Delta variant genome (personal communication, G. Van Domselaar). This assay was designed to detect both WT and variant (V) sequences for each allele, allowing for discrimination between V and WT SARS-CoV-2 RNA.

The WT SARS-CoV-2 (NC_045512.1) sequence, along with Delta variant sequences (EPI_ISL_1372093, EPI_ISL_2134533, EPI_ISL_2134644, EPI_ISL_2134933, EPI_ISL_2135087), were obtained from Global Initiative on Sharing Avian Influenza Data ^{Footnote 18} and used for primer and probe design. Oligonucleotide primers and probes were chosen for each target region using Primer Express Software v3.0 (Thermo Fisher Scientific, Waltham, Massachusetts) and Primer3 v4.1.0 ^{Footnote 19}. Linear dsDNA oligonucleotide gene fragments (Integrated DNA, Coralville, Iowa) consisting of the gene region flanking the variant region for either the WT or variant sequence (Table A1) were employed as standards and quantified using a One-Step RT-ddPCR Advanced Kit for Probes (Bio-Rad, Mississauga, Ontario) on a QX200 Droplet Digital PCR System (Bio-Rad).

Real-time quantitative reverse transcription polymerase chain reaction assay conditions

RT-qPCR was performed for D377Y WT and V assays, along with the United States Centers for Disease Control and Prevention N1 and N2 assays and interpreted as previously described ^{Footnote 14 Footnote 20} with concentrations of 500 nM of each primer (D377Y_F: CATTCCCACCAACAGAGCCT, D377Y_R: TGTCTCTGCGGTAAGGCTTG) and 500 nM of each probe (D377Y_WT: AGAAGGCTGATGAAA, D377Y_V: AGAAGGCTTATGAAAC). Each real-time PCR was performed in duplicate or triplicate as indicated with the appropriate non-template controls and positive controls.

Determination of limit of detection

The assay limit of detection (LOD) was assessed as the lowest concentration at which there was >95% test positivity in 15 replicates of a 1.5-fold serial dilution series from 45 copies/reaction (cp/rxn) to 1.8 cp/rxn of dsDNA oligonucleotide standards.

Data analyses

Amplification efficiencies (E) were calculated using E=−1 + 10^(-1/slope) x 100. Data analyses were performed using R version 4.1.1 on Rstudio using the tidyverse packages ^{Footnote 21}.

Results

The assay limits of detection were 4 cp/rxn (WT) and 3 cp/rxn (V) when measured as a pure specimen without interfering alleles. These LODs were near the theoretical limit of RT-qPCR and sufficient for sensitive detection in wastewater, where SARS-CoV-2 RNA concentrations can be very low. Standard curves were as follows: WT (slope=−3.45, intercept=38.52, R²=0.999); and V (slope=−3.29, intercept=38.25, R²=0.999). The amplification efficiencies of the WT and V reactions were 101% and 95%, respectively.

As relative amounts of WT and V template within wastewater samples may vary considerably, standard curves were also created for each assay in the presence of 100, 500 and 1,000 cp/µL of the alternate allele to assess their stability (Figure 1). Presence of the WT template had a limited effect on V template detection with the variant assay, with a loss of signal at 1 cp/µL V only in the presence of 1,000 cp/µL WT; a concentration much higher than is likely to be detected in wastewater. Presence of V template led to decreased sensitivity and increased range of error of the WT assay, with detection at 10 cp/µL WT, but not 1 cp/µL WT in the presence of any concentration of V template. Standard deviations of both assays were determined using the alternate alleles in this experiment to assess variance over a range of concentrations. Standard deviations were averaged across three concentrations (100 cp/µL, 500 cp/µL and 1,000 cp/µL) and were 0.38 Ct (WT) and 0.31 (V) compared with 0.09–0.18 for previously published assays ^{Footnote 14}.

Figure 1 - Text description

Copies	Log copies	Competitive copies	Assay	Locus	Allele	Rep1	Rep2	Rep3	Avg	Stdev
10,000	4.699	-	D377Y_WT	D377Y	WT	22.81	22.78	22.66	22.75	0.079646
1,000	3.699	-	D377Y_WT	D377Y	WT	26.15	26.21	26.39	26.25	0.124343
100	2.699	-	D377Y_WT	D377Y	WT	29.34	29.62	29.73	29.56	0.203482
10	1.699	-	D377Y_WT	D377Y	WT	32.72	32.90	32.81	32.81	0.089652
1	0.699	-	D377Y_WT	D377Y	WT	36.60	35.07	35.26	35.64	0.836539
10,000	4.699	100	D377Y_WT	D377Y	WT	21.87	21.97	22.38	22.07	0.267775
1,000	3.699	100	D377Y_WT	D377Y	WT	25.92	25.68	26.25	25.95	0.289072
100	2.699	100	D377Y_WT	D377Y	WT	29.61	29.26	29.47	29.45	0.176541
10	1.699	100	D377Y_WT	D377Y	WT	33.21	33.42	32.60	33.07	0.425187
1	0.699	100	D377Y_WT	D377Y	WT	ND	ND	ND	NA	NA
10,000	4.699	500	D377Y_WT	D377Y	WT	23.14	23.14	23.34	23.21	0.115114
1,000	3.699	500	D377Y_WT	D377Y	WT	26.35	26.44	26.47	26.42	0.058017
100	2.699	500	D377Y_WT	D377Y	WT	30.19	29.88	30.42	30.16	0.268748
10	1.699	500	D377Y_WT	D377Y	WT	36.76	ND	36.06	36.41	0.493931
1	0.699	500	D377Y_WT	D377Y	WT	ND	ND	ND	NA	NA
10,000	4.699	1,000	D377Y_WT	D377Y	WT	23.21	23.07	22.86	23.04	0.173106
1,000	3.699	1,000	D377Y_WT	D377Y	WT	25.34	25.51	26.32	25.72	0.527344
100	2.699	1,000	D377Y_WT	D377Y	WT	30.32	30.37	30.66	30.45	0.18057
10	1.699	1,000	D377Y_WT	D377Y	WT	ND	38.21	ND	38.21	NA
1	0.699	1,000	D377Y_WT	D377Y	WT	ND	ND	ND	NA	NA
10,000	4.699	-	D377Y_V	D377Y	V	22.35	22.50	22.48	22.44	0.076794
1,000	3.699	-	D377Y_V	D377Y	V	25.71	25.79	25.30	25.60	0.265688
100	2.699	-	D377Y_V	D377Y	V	29.49	29.47	29.57	29.51	0.055552
10	1.699	-	D377Y_V	D377Y	V	32.51	32.78	33.58	32.96	0.552422
1	0.699	-	D377Y_V	D377Y	V	36.66	35.85	34.67	35.73	1.002303
10,000	4.699	100	D377Y_V	D377Y	V	21.65	21.48	21.01	21.38	0.334804
1,000	3.699	100	D377Y_V	D377Y	V	25.48	25.08	24.67	25.07	0.401667
100	2.699	100	D377Y_V	D377Y	V	28.96	28.98	28.88	28.94	0.05023
10	1.699	100	D377Y_V	D377Y	V	32.61	33.36	32.99	32.99	0.377475
1	0.699	100	D377Y_V	D377Y	V	38.04	37.95	36.90	37.63	0.632686
10,000	4.699	500	D377Y_V	D377Y	V	22.89	22.32	21.77	22.33	0.55805
1,000	3.699	500	D377Y_V	D377Y	V	26.24	26.00	26.09	26.11	0.121814
100	2.699	500	D377Y_V	D377Y	V	29.60	29.24	29.74	29.52	0.257033
10	1.699	500	D377Y_V	D377Y	V	34.75	33.79	34.84	34.46	0.58128
1	0.699	500	D377Y_V	D377Y	V	ND	ND	38.34	38.34	NA
10,000	4.699	1,000	D377Y_V	D377Y	V	21.42	21.63	20.89	21.31	0.378906
1,000	3.699	1,000	D377Y_V	D377Y	V	26.02	26.04	25.24	25.76	0.458344
100	2.699	1,000	D377Y_V	D377Y	V	30.76	29.91	30.20	30.29	0.429528
10	1.699	1,000	D377Y_V	D377Y	V	37.53	34.37	35.22	35.71	1.634639
1	0.699	1,000	D377Y_V	D377Y	V	ND	ND	ND	NA	NA
Figure 1 abbreviations Abbreviations: NA, not available; ND, not detected

To test analytical specificity, both WT and V targets were tested in triplicate against serial dilutions from 10⁶ cp/µL to 10⁰ cp/µL of the alternate allele oligonucleotide. The WT assay showed negligible cross-reactivity, with a 25 Ct delayed detection in the presence of 1 x 10⁶ cp/µL WT. The V assay showed cross reactivity with the WT template; however, the amplification was delayed by ~8 Ct (Figure 2).

Figure 2 - Text description

Copies	Log copies	Competitive copies	Locus	Allele	Template	Rep1	Rep2	Rep3	Avg	Stdev
1,000,000	6.699	0	D377Y	V	V	16.23	16.13	16.12	16.16	0.063428
100,000	5.699	0	D377Y	V	V	19.42	19.11	19.55	19.36	0.227545
10,000	4.699	0	D377Y	V	V	22.81	22.78	22.66	22.75	0.079646
1,000	3.699	0	D377Y	V	V	26.15	26.21	26.39	26.25	0.124343
100	2.699	0	D377Y	V	V	29.34	29.62	29.73	29.56	0.203482
10	1.699	0	D377Y	V	V	32.72	32.90	32.81	32.81	0.089652
1	0.699	0	D377Y	V	V	36.60	35.07	35.26	35.64	0.836539
1,000,000	6.699	0	D377Y	V	WT	24.42	23.44	24.40	24.09	0.56325
100,000	5.699	0	D377Y	V	WT	27.96	27.54	27.62	27.70	0.225158
10,000	4.699	0	D377Y	V	WT	31.38	31.72	31.26	31.45	0.239828
1,000	3.699	0	D377Y	V	WT	34.12	35.26	35.14	34.84	0.621706
100	2.699	0	D377Y	V	WT	37.61	38.65	38.06	38.10	0.518656
10	1.699	0	D377Y	V	WT	42.65	42.34	42.14	42.38	0.25774
1	0.699	0	D377Y	V	WT	ND	ND	ND	NA	NA
1,000,000	6.699	0	D377Y	WT	WT	15.53	15.10	15.50	15.38	0.237491
100,000	5.699	0	D377Y	WT	WT	18.82	18.71	18.80	18.78	0.057041
10,000	4.699	0	D377Y	WT	WT	22.35	22.50	22.48	22.44	0.076794
1,000	3.699	0	D377Y	WT	WT	25.71	25.79	25.30	25.60	0.265688
100	2.699	0	D377Y	WT	WT	29.49	29.47	29.57	29.51	0.055552
10	1.699	0	D377Y	WT	WT	32.51	32.78	33.58	32.96	0.552422
1	0.699	0	D377Y	WT	WT	36.66	35.85	34.67	35.73	1.002303
1,000,000	6.699	0	D377Y	WT	V	ND	39.86	ND	39.86	NA
100,000	5.699	0	D377Y	WT	V	ND	ND	ND	NA	NA
10,000	4.699	0	D377Y	WT	V	ND	ND	ND	NA	NA
1,000	3.699	0	D377Y	WT	V	ND	ND	ND	NA	NA
100	2.699	0	D377Y	WT	V	ND	ND	ND	NA	NA
10	1.699	0	D377Y	WT	V	ND	ND	ND	NA	NA
1	0.699	0	D377Y	WT	V	ND	ND	ND	NA	NA
Figure 2 abbreviations Abbreviations: NA, not available; ND, not detected

A total of 980 samples from 36 urban and remote WWTPs and lift stations across Canada were sampled from June 30 to December 1, 2021 (Table A2). Of these, 539 (55%) tested positive for the SARS-CoV-2 Delta variant D377Y mutation, 210 (21.4%) tested positive for N1/N2 only and 232 (23.6%) samples were negative for both N1/N2 and D377Y. Additionally, there were 8 (0.8%) samples in which SARS-CoV-2 was detected by the D377Y assays but not N1/N2, of which seven had D377Y detection in only one of two replicates and six had detection <10 cp/mL. The Delta variant was detected in all six major cities, with initial detection ranging from July 11 to August 30 in the larger cities and October 7 in NL11 (St. John's) (Figure 3). Delta variant signal was initially detected in the majority of cities between July 17 and 22. The peak signal (highest concentration of Delta detected) in the cities throughout the study period ranged from July 22 to October 18, averaging 32 days after initial detection (range: 0–66, IQR: 10–49). Following initial detection in five of the six cities, Delta signal rapidly increased, becoming roughly equivalent to the SARS-CoV-2 N1 + N2 signal throughout the remainder of the study period. This sharp increase is indicative of rapid displacement of other circulating variants by Delta, as seen in clinical cases by genomic surveillance of SARS-CoV-2 variants. In St. John's, Newfoundland and Labrador, Delta signal was detected only twice during the study period and SARS-CoV-2 signal remained low; a pattern typically seen in the more remote locations in this study.

Figure 3 - Text description

Sample_ID	Site	Date_sampled	S_N1N2_avg	S_D377Y_Var_avg
WW21-2384	AB1	2021-07-08	3	1
WW21-2385	AB1	2021-07-11	3	1
WW21-2386	ON1	2021-07-11	4.5	3
WW21-2387	ON2	2021-07-11	5.1	1
WW21-2388	ON3	2021-07-11	3	1
WW21-2389	ON4	2021-07-11	1	1
WW21-2390	NL11	2021-07-13	1	1
WW21-2393	NS1	2021-07-05	1	1
WW21-2394	NS2	2021-07-05	4	1
WW21-2395	NS3	2021-07-05	3	1
WW21-2396	NS1	2021-07-07	3	1
WW21-2397	NS2	2021-07-07	4.4	1
WW21-2398	NS3	2021-07-08	1	1
WW21-2412	ON1	2021-07-15	3.2	1
WW21-2413	ON2	2021-07-15	3	1
WW21-2414	ON3	2021-07-15	5.7	1
WW21-2415	ON4	2021-07-15	1	1
WW21-2417	NL11	2021-07-15	1	1
WW21-2421	QC1	2021-07-14	3	1
WW21-2422	QC2	2021-07-14	5	1
WW21-2423	QC1	2021-07-17	3	1
WW21-2424	QC2	2021-07-17	3	1
WW21-2436	NL11	2021-07-19	1	1
WW21-2449	ON1	2021-07-18	3	1
WW21-2450	ON2	2021-07-18	6.5	12.9
WW21-2451	ON3	2021-07-18	6.2	4.3
WW21-2452	ON4	2021-07-18	3	1
WW21-2453	AB1	2021-07-15	3	1
WW21-2454	AB1	2021-07-18	7	3.2
WW21-2458	NT5	2021-06-30	1	1
WW21-2459	NT5	2021-07-07	1	1
WW21-2470	BC1	2021-07-15	3	1
WW21-2471	BC2	2021-07-15	6.2	1
WW21-2472	BC4	2021-07-15	3	1
WW21-2473	BC3	2021-07-15	3	1
WW21-2474	BC5	2021-07-15	5.5	1
WW21-2475	BC1	2021-07-18	4.5	1
WW21-2476	BC2	2021-07-18	3	1
WW21-2477	BC4	2021-07-18	3.3	1
WW21-2478	BC3	2021-07-18	4.7	1
WW21-2479	BC5	2021-07-18	3	1
WW21-2480	NS1	2021-07-12	1	1
WW21-2481	NS2	2021-07-12	4.1	1
WW21-2482	NS3	2021-07-12	3	1
WW21-2483	NS1	2021-07-14	1	1
WW21-2484	NS2	2021-07-14	3	1
WW21-2485	NS3	2021-07-14	1	1
WW21-2501	NU1	2021-07-14	1	1
WW21-2502	NU1	2021-07-16	1	1
WW21-2503	NU1	2021-07-19	1	1
WW21-2506	ON1	2021-07-20	4.5	1
WW21-2507	ON2	2021-07-20	3.9	1
WW21-2508	ON3	2021-07-20	7.1	7.2
WW21-2509	ON4	2021-07-20	1	1
WW21-2510	NL10	2021-07-22	1	1
WW21-2512	NL11	2021-07-22	1	1
WW21-2515	NU2	2021-07-22	1	1
WW21-2520	BC1	2021-07-22	8.9	15.2
WW21-2521	BC2	2021-07-22	5.9	3
WW21-2522	BC3	2021-07-22	3	3
WW21-2523	BC4	2021-07-22	52.3	102
WW21-2524	BC5	2021-07-22	7.6	22.9
WW21-2525	BC1	2021-07-25	3.7	3
WW21-2526	BC2	2021-07-25	5.6	1
WW21-2527	BC3	2021-07-25	6.6	9.6
WW21-2528	BC4	2021-07-25	9.7	14
WW21-2529	BC5	2021-07-25	3	1
WW21-2530	QC1	2021-07-21	3	3.9
WW21-2531	QC2	2021-07-21	3	1
WW21-2532	QC1	2021-07-24	4	1
WW21-2533	QC2	2021-07-24	4.5	1
WW21-2544	NL11	2021-07-26	1	1
WW21-2547	NU1	2021-07-21	1	1
WW21-2558	ON1	2021-07-25	4.5	3
WW21-2559	ON2	2021-07-25	4.5	1
WW21-2560	ON3	2021-07-25	8.9	8.4
WW21-2561	ON4	2021-07-25	3	1
WW21-2562	AB1	2021-07-22	3.5	3.4
WW21-2563	AB1	2021-07-25	7.7	3
WW21-2564	NS1	2021-07-19	3	1
WW21-2565	NS2	2021-07-19	1	1
WW21-2566	NS3	2021-07-19	3	1
WW21-2567	NS1	2021-07-22	1	1
WW21-2568	NS2	2021-07-22	3	1
WW21-2569	NS3	2021-07-22	3	1
WW21-2589	NU2	2021-07-26	1	1
WW21-2590	NU2	2021-07-27	1	1
WW21-2591	ON1	2021-07-27	3.9	1
WW21-2592	ON2	2021-07-27	36.9	69
WW21-2593	ON4	2021-07-27	3	1
WW21-2595	NL11	2021-07-29	3	1
WW21-2608	NL11	2021-08-02	1	1
WW21-2615	NU1	2021-07-28	3	1
WW21-2616	NL10	2021-07-30	1	1
WW21-2619	BC2	2021-07-29	8.1	1
WW21-2620	BC3	2021-07-29	8.3	12.3
WW21-2621	BC4	2021-07-29	4.8	5
WW21-2622	BC5	2021-07-29	17.7	56.9
WW21-2623	BC1	2021-08-01	4.7	1
WW21-2624	BC2	2021-08-01	5.1	21
WW21-2625	BC3	2021-08-01	5.9	20.8
WW21-2626	BC4	2021-08-01	5.1	3
WW21-2627	BC5	2021-08-01	45.6	4.5
WW21-2628	ON1	2021-08-01	3.6	6.2
WW21-2629	ON2	2021-08-01	3	1
WW21-2630	ON3	2021-08-01	9.1	20.6
WW21-2631	ON4	2021-08-01	3.4	1
WW21-2632	QC1	2021-07-28	4.2	1
WW21-2633	QC2	2021-07-28	3	1
WW21-2634	QC1	2021-07-31	3.7	1
WW21-2635	QC2	2021-07-31	3	1
WW21-2647	NU2	2021-07-28	1	1
WW21-2648	NU2	2021-07-29	1	1
WW21-2652	AB1	2021-07-29	10.7	13.4
WW21-2653	AB1	2021-08-01	11.8	6.3
WW21-2665	NU2	2021-08-03	1	1
WW21-2668	ON1	2021-08-03	9.1	9
WW21-2669	ON2	2021-08-03	10.4	4.3
WW21-2670	ON3	2021-08-03	13.5	3
WW21-2671	ON4	2021-08-03	3	3
WW21-2672	NS1	2021-07-26	3	1
WW21-2673	NS2	2021-07-26	1	1
WW21-2674	NS3	2021-07-26	3	1
WW21-2675	NS1	2021-07-28	1	1
WW21-2676	NS2	2021-07-28	3	1
WW21-2677	NS3	2021-07-28	1	1
WW21-2681	NU2	2021-08-04	1	1
WW21-2682	NU2	2021-08-05	1	1
WW21-2688	BC1	2021-08-05	16.2	22.3
WW21-2689	BC2	2021-08-05	25.7	52
WW21-2690	BC3	2021-08-05	19.9	56.2
WW21-2691	BC4	2021-08-05	14.7	7.9
WW21-2692	BC5	2021-08-05	18.9	27
WW21-2693	BC1	2021-08-08	13.6	11.1
WW21-2694	BC2	2021-08-08	6.4	10
WW21-2695	BC3	2021-08-08	52.4	82.8
WW21-2696	BC4	2021-08-08	7.8	12
WW21-2697	BC5	2021-08-08	10.6	17.9
WW21-2698	QC1	2021-08-04	6.5	1
WW21-2699	QC2	2021-08-04	8.1	1
WW21-2700	QC1	2021-08-07	9.6	3
WW21-2701	QC2	2021-08-07	3.3	1
WW21-2702	NS1	2021-08-02	3	1
WW21-2703	NS2	2021-08-02	3	1
WW21-2704	NS3	2021-08-02	1	1
WW21-2705	NS1	2021-08-04	1	1
WW21-2706	NS2	2021-08-04	7	3
WW21-2707	NS3	2021-08-04	1	1
WW21-2718	NL11	2021-08-09	1	1
WW21-2722	NU1	2021-08-04	1	1
WW21-2723	NU1	2021-08-06	1	1
WW21-2724	NT5	2021-07-30	1	1
WW21-2725	NT5	2021-08-03	1	1
WW21-2726	NT5	2021-08-01	1	1
WW21-2733	AB1	2021-08-05	27.6	73.2
WW21-2734	AB1	2021-08-08	19.5	25.7
WW21-2735	ON1	2021-08-08	14.5	15.7
WW21-2736	ON2	2021-08-08	6.5	6.8
WW21-2737	ON3	2021-08-08	10.1	14.8
WW21-2738	ON4	2021-08-08	6.6	1
WW21-2758	ON1	2021-08-10	18.5	31.5
WW21-2759	ON2	2021-08-10	13.4	1
WW21-2760	ON3	2021-08-10	10.5	5.7
WW21-2761	ON4	2021-08-10	12.4	9.4
WW21-2762	NL11	2021-08-12	1	1
WW21-2764	NL10	2021-08-12	3	1
WW21-2775	NL10	2021-08-12	64.1	1
WW21-2776	NU2	2021-08-09	1	1
WW21-2777	NU2	2021-08-10	1	1
WW21-2778	NU2	2021-08-11	1	1
WW21-2781	BC1	2021-08-12	13.1	11.6
WW21-2782	BC2	2021-08-12	21.8	18
WW21-2783	BC3	2021-08-12	28.4	40.3
WW21-2784	BC4	2021-08-12	4.8	3
WW21-2785	BC5	2021-08-12	18.4	22.3
WW21-2786	BC1	2021-08-15	14	15.3
WW21-2787	BC3	2021-08-15	19.1	10.1
WW21-2788	BC4	2021-08-15	6.9	6
WW21-2789	BC5	2021-08-15	10.2	3
WW21-2790	QC1	2021-08-11	12.9	15.1
WW21-2791	QC2	2021-08-11	9.8	3
WW21-2792	QC1	2021-08-14	13.7	4.8
WW21-2793	QC2	2021-08-14	6.6	1
WW21-2804	NL11	2021-08-16	1	1
WW21-2807	AB1	2021-08-12	51.1	54.3
WW21-2808	AB1	2021-08-15	46.6	74.5
WW21-2809	ON1	2021-08-15	23.9	44.7
WW21-2810	ON2	2021-08-15	16.1	30.5
WW21-2811	ON3	2021-08-15	52.6	86.7
WW21-2812	ON4	2021-08-15	22.1	37.2
WW21-2816	NS1	2021-08-09	1	1
WW21-2817	NS2	2021-08-09	3	1
WW21-2818	NS3	2021-08-09	1	1
WW21-2819	NS1	2021-08-11	5.2	1
WW21-2820	NS2	2021-08-11	3.8	1
WW21-2821	NS3	2021-08-11	1	1
WW21-2833	ON1	2021-08-17	34.1	33.6
WW21-2834	ON2	2021-08-17	21.2	22.4
WW21-2835	ON3	2021-08-17	20	25.3
WW21-2836	ON4	2021-08-17	10.6	7.1
WW21-2837	NL11	2021-08-19	3	1
WW21-2840	NL10	2021-08-19	3	1
WW21-2841	NU1	2021-08-09	1	1
WW21-2842	NU1	2021-08-11	1	1
WW21-2843	NU1	2021-08-13	1	1
WW21-2844	NU1	2021-08-16	1	1
WW21-2845	NU2	2021-08-16	1	1
WW21-2846	NU2	2021-08-17	42.5	63.1
WW21-2915	NL11	2021-08-26	3	1
WW21-2918	NL10	2021-08-26	3	1
WW21-2919	NU1	2021-08-20	1	1
WW21-2920	NU1	2021-08-23	1	1
WW21-2921	NU2	2021-08-25	3	1
WW21-2922	NU2	2021-08-26	1	1
WW21-2923	ON1	2021-08-24	7.3	11.1
WW21-2924	ON2	2021-08-24	13.1	11.6
WW21-2925	ON3	2021-08-24	15.8	20
WW21-2926	ON4	2021-08-24	10.2	4.8
WW21-2929	NT3	2021-08-16	1	3
WW21-2930	NT4	2021-08-16	3	1
WW21-2931	NT5	2021-08-12	1	3
WW21-2932	NT5	2021-08-13	3	1
WW21-2933	NT5	2021-08-16	3.6	1
WW21-2934	NT5	2021-08-17	3	3
WW21-2935	NU2	2021-08-28	1	1
WW21-2936	NU2	2021-08-29	1	1
WW21-2939	BC1	2021-08-26	24.5	49.3
WW21-2940	BC2	2021-08-26	38.9	87.9
WW21-2941	BC3	2021-08-26	38	53.3
WW21-2942	BC4	2021-08-26	16.1	32
WW21-2943	BC5	2021-08-26	38.6	63.9
WW21-2944	BC1	2021-08-29	18.3	31
WW21-2945	BC2	2021-08-29	18.6	40.4
WW21-2946	BC3	2021-08-29	24	46.9
WW21-2947	BC4	2021-08-29	5.6	15.5
WW21-2948	BC5	2021-08-29	13.8	17.8
WW21-2949	QC1	2021-08-25	12.1	20.7
WW21-2950	QC2	2021-08-25	7.9	8
WW21-2951	QC1	2021-08-28	15.1	30.4
WW21-2952	QC2	2021-08-28	13.5	7.9
WW21-2963	NL11	2021-08-30	3	1
WW21-2964	NL10	2021-08-30	8	6.1
WW21-2969	NT4	2021-08-19	40.2	97.8
WW21-2970	NT5	2021-08-18	4.2	5.3
WW21-2971	NT5	2021-08-19	2.9	10.8
WW21-2972	NT6	2021-08-19	4.2	3
WW21-2973	NT5	2021-08-20	4.1	12
WW21-2974	NT6	2021-08-20	3	5.1
WW21-2975	NT5	2021-08-21	9.3	13
WW21-2976	NT6	2021-08-21	3	3
WW21-2977	NT5	2021-08-22	5.2	6.8
WW21-2978	NT6	2021-08-22	3	3
WW21-2982	AB1	2021-08-26	72.7	119.5
WW21-2983	AB1	2021-08-29	63.2	71.4
WW21-2990	NU1	2021-08-25	3	1
WW21-2991	NU2	2021-08-27	3	1
WW21-2992	NU2	2021-08-30	1	1
WW21-2996	ON1	2021-08-29	75.9	152.8
WW21-2997	ON2	2021-08-29	10.2	5.4
WW21-2998	ON3	2021-08-29	13	9
WW21-2999	ON4	2021-08-29	6.9	3.5
WW21-3000	NS1	2021-08-23	3	1
WW21-3001	NS2	2021-08-23	4.9	1
WW21-3002	NS3	2021-08-23	3.3	1
WW21-3003	NS1	2021-08-25	3	1
WW21-3004	NS2	2021-08-25	4.4	1
WW21-3005	NS3	2021-08-25	3	1
WW21-3013	NU1	2021-08-27	3	1
WW21-3014	NU1	2021-08-30	1	1
WW21-3015	NU2	2021-08-31	3	3
WW21-3016	NU2	2021-09-01	3	1
WW21-3017	NU2	2021-09-02	1	1
WW21-3021	NL10	2021-09-02	1	3
WW21-3023	NL11	2021-09-02	1	1
WW21-3048	BC1	2021-09-02	23.1	33.7
WW21-3049	BC2	2021-09-02	38.8	80.9
WW21-3050	BC3	2021-09-02	36.7	42.2
WW21-3051	BC4	2021-09-02	20.1	23.9
WW21-3052	BC5	2021-09-02	21.4	26.3
WW21-3053	BC1	2021-09-05	39.4	56.5
WW21-3054	BC2	2021-09-05	23.9	28.7
WW21-3055	BC3	2021-09-05	29	32.9
WW21-3056	BC4	2021-09-05	15.2	23.8
WW21-3057	BC5	2021-09-05	93.3	111.1
WW21-3058	QC1	2021-09-01	17	20.1
WW21-3059	QC2	2021-09-01	6.6	12.8
WW21-3060	QC1	2021-09-04	15.7	21.9
WW21-3061	QC2	2021-09-04	5.7	10.6
WW21-3068	NL11	2021-09-07	3	1
WW21-3069	NU2	2021-09-07	6.8	1
WW21-3074	AB1	2021-09-02	194.2	210.4
WW21-3075	AB1	2021-09-05	168.2	259.4
WW21-3076	NS1	2021-08-30	3	4
WW21-3077	NS2	2021-08-30	1	3.2
WW21-3078	NS3	2021-08-30	3	3
WW21-3079	NS1	2021-09-01	3	1
WW21-3080	NS2	2021-08-30	3	1
WW21-3081	NS3	2021-09-01	3	1
WW21-3090	NU2	2021-09-08	3	258
WW21-3091	NU2	2021-09-09	1	1
WW21-3094	NL11	2021-09-09	1	1
WW21-3095	NL10	2021-09-09	3	3
WW21-3104	NU1	2021-09-01	3	1
WW21-3105	NU1	2021-09-03	1	1
WW21-3106	NU1	2021-09-08	1	1
WW21-3109	BC1	2021-09-09	35.8	62.3
WW21-3110	BC2	2021-09-09	30.1	62.1
WW21-3111	BC3	2021-09-09	46.2	93.7
WW21-3112	BC4	2021-09-09	5.9	6.5
WW21-3113	BC5	2021-09-09	47.6	74.1
WW21-3114	BC1	2021-09-12	90.8	138.6
WW21-3115	BC2	2021-09-12	64.7	128
WW21-3116	BC3	2021-09-12	77	167.1
WW21-3117	BC4	2021-09-12	11.3	22.4
WW21-3118	BC5	2021-09-12	22.4	39.4
WW21-3119	QC1	2021-09-08	30.2	43.3
WW21-3120	QC2	2021-09-08	12.7	14.2
WW21-3121	QC1	2021-09-11	30.1	41.2
WW21-3122	QC2	2021-09-11	10.9	9.2
WW21-3132	NL11	2021-09-13	3	1
WW21-3140	AB1	2021-09-09	86.8	116.8
WW21-3141	AB1	2021-09-12	114.5	161.6
WW21-3142	ON1	2021-09-12	23.8	42.1
WW21-3143	ON2	2021-09-12	23	19.7
WW21-3144	ON3	2021-09-12	16.4	17
WW21-3145	ON4	2021-09-12	20.6	22.1
WW21-3159	NS1	2021-09-06	3	6.8
WW21-3160	NS2	2021-09-06	75.8	144.3
WW21-3161	NS3	2021-09-06	3.7	1
WW21-3162	NS1	2021-09-08	3	1
WW21-3163	NS2	2021-09-08	13.4	43
WW21-3164	NS3	2021-09-08	3	3
WW21-3175	NT5	2021-08-23	4.5	5.2
WW21-3176	NT6	2021-08-23	5	3
WW21-3177	NT5	2021-08-24	4.3	11.6
WW21-3178	NT6	2021-08-24	3	1
WW21-3179	NT5	2021-08-25	3.4	8.1
WW21-3180	NT6	2021-08-25	4.3	8.5
WW21-3181	NT5	2021-08-26	3	3
WW21-3182	NT6	2021-08-26	7.2	20.7
WW21-3183	NT3	2021-08-25	6.8	19.3
WW21-3184	NT4	2021-08-19	26.9	8.1
WW21-3185	NT4	2021-08-23	55.6	66.6
WW21-3186	NT4	2021-08-26	67.1	69.8
WW21-3189	NU2	2021-09-13	1	7.5
WW21-3190	NU2	2021-09-14	1	1
WW21-3191	NU1	2021-09-06	1	1
WW21-3192	NU1	2021-09-10	1	4.3
WW21-3193	NL11	2021-09-16	3	1
WW21-3197	NL10	2021-09-16	3	1
WW21-3199	ON1	2021-09-14	13.6	54.8
WW21-3200	ON2	2021-09-14	15.6	25.2
WW21-3201	ON3	2021-09-14	15.2	37.4
WW21-3202	ON4	2021-09-14	34.3	94.9
WW21-3205	BC1	2021-09-16	25	19.8
WW21-3206	BC2	2021-09-16	22.1	9.8
WW21-3207	BC3	2021-09-16	36.9	31.9
WW21-3208	BC4	2021-09-16	12.3	12.4
WW21-3209	BC5	2021-09-16	27.8	31.3
WW21-3210	BC1	2021-09-19	49.8	31.5
WW21-3211	BC2	2021-09-19	44.4	28.1
WW21-3212	BC3	2021-09-19	16.2	16.1
WW21-3213	BC4	2021-09-19	14.1	11.9
WW21-3214	BC5	2021-09-19	15.5	6.9
WW21-3215	QC1	2021-09-15	19.1	8.1
WW21-3216	QC2	2021-09-15	14.5	7.3
WW21-3217	QC1	2021-09-18	16.2	16.9
WW21-3218	QC2	2021-09-18	9	8.9
WW21-3229	NL11	2021-09-20	1	1
WW21-3236	NT5	2021-08-27	5	14.4
WW21-3237	NT5	2021-08-28	7	62.7
WW21-3238	NT5	2021-08-29	7.7	21.4
WW21-3239	NT5	2021-08-30	5.7	20.1
WW21-3240	NT5	2021-08-31	36.3	40.4
WW21-3241	NT5	2021-09-01	17.4	20.5
WW21-3242	NT5	2021-09-02	29.1	30
WW21-3243	NT5	2021-09-03	18.8	28.4
WW21-3244	NT5	2021-09-04	15	17.6
WW21-3245	NT5	2021-09-05	167	141.5
WW21-3246	NT5	2021-09-06	41.9	46.7
WW21-3247	NT5	2021-09-07	41.3	38.8
WW21-3248	NT5	2021-09-08	37.8	32.5
WW21-3249	NT5	2021-09-09	15.7	16
WW21-3250	NT5	2021-09-10	18.9	24.3
WW21-3251	NT5	2021-09-11	33.6	33.4
WW21-3252	NT5	2021-09-12	29.1	29.6
WW21-3253	NT5	2021-09-13	45.9	42.8
WW21-3254	NT5	2021-09-14	31.4	32.1
WW21-3255	NT6	2021-09-01	8.3	8.8
WW21-3256	NT6	2021-09-10	3	3.1
WW21-3257	NT6	2021-09-13	3	18.6
WW21-3258	NT3	2021-09-07	35.5	22.5
WW21-3259	NT4	2021-08-30	189	100.6
WW21-3260	NT4	2021-09-02	36.8	25.2
WW21-3261	NT4	2021-09-06	14.4	7.8
WW21-3262	NT4	2021-09-09	8.3	3
WW21-3270	NU2	2021-09-15	1	1
WW21-3271	NU2	2021-09-16	1	1
WW21-3272	NU2	2021-09-20	1	1
WW21-3273	NU2	2021-09-21	1	1
WW21-3274	NU1	2021-09-13	3	1
WW21-3275	NU1	2021-09-15	3	1
WW21-3280	AB1	2021-09-16	74.4	40.7
WW21-3281	AB1	2021-09-19	76.5	48
WW21-3282	ON1	2021-09-19	8.6	7.9
WW21-3283	ON2	2021-09-19	10.7	6.6
WW21-3284	ON3	2021-09-19	29.7	16.1
WW21-3285	ON4	2021-09-19	7.6	5.1
WW21-3286	NS1	2021-09-13	6.5	3
WW21-3287	NS2	2021-09-13	5.2	3
WW21-3288	NS3	2021-09-13	3	1
WW21-3289	NS1	2021-09-15	6.8	4.6
WW21-3290	NS2	2021-09-15	5	3
WW21-3291	NS3	2021-09-15	3	1
WW21-3306	NL11	2021-09-23	1	1
WW21-3309	NL10	2021-09-23	54.8	5.6
WW21-3311	NT5	2021-09-14	28.5	32.9
WW21-3312	NT5	2021-09-16	15.4	12.4
WW21-3313	NT5	2021-09-17	26.8	21.7
WW21-3314	NT6	2021-09-17	3.9	3.7
WW21-3315	NT5	2021-09-20	63.6	49.3
WW21-3316	NT6	2021-09-20	3.6	5.2
WW21-3317	NT3	2021-09-14	4.9	4.2
WW21-3318	NT3	2021-09-16	14.7	9.5
WW21-3319	NT4	2021-09-16	6.5	4.2
WW21-3324	NU2	2021-09-22	1	1
WW21-3325	NU2	2021-09-23	1	1
WW21-3330	NU1	2021-09-20	3	1
WW21-3335	QC1	2021-09-22	8.5	4.6
WW21-3336	QC2	2021-09-22	10.3	7.2
WW21-3337	QC1	2021-09-25	15.2	4.2
WW21-3338	QC2	2021-09-25	5.2	1
WW21-3349	NL11	2021-09-27	3	1
WW21-3353	BC1	2021-09-23	26.8	28.6
WW21-3354	BC2	2021-09-23	25.9	18
WW21-3355	BC3	2021-09-23	12.9	6.4
WW21-3356	BC4	2021-09-23	13.4	9.1
WW21-3357	BC5	2021-09-23	11.1	11.5
WW21-3358	BC1	2021-09-26	16.2	12.1
WW21-3359	BC2	2021-09-26	43.7	31.9
WW21-3360	BC3	2021-09-26	12.1	8.8
WW21-3361	BC4	2021-09-26	7.2	6.3
WW21-3362	BC5	2021-09-26	64.2	33.9
WW21-3363	AB1	2021-09-23	127.5	79.9
WW21-3364	AB1	2021-09-26	50.9	29.3
WW21-3365	NS1	2021-09-20	13.7	12.7
WW21-3366	NS2	2021-09-20	8.1	3
WW21-3367	NS3	2021-09-20	3	1
WW21-3368	NS1	2021-09-22	10.1	4.1
WW21-3369	NS2	2021-09-22	17.1	11
WW21-3370	NS3	2021-09-22	3.7	1
WW21-3382	ON1	2021-09-21	9.4	6.4
WW21-3383	ON2	2021-09-21	50.5	42.5
WW21-3384	ON3	2021-09-21	22.9	16.1
WW21-3385	ON4	2021-09-21	11.2	8.9
WW21-3386	ON1	2021-09-26	4.4	3
WW21-3387	ON2	2021-09-26	12.3	6.9
WW21-3388	ON3	2021-09-26	19.6	11.5
WW21-3389	ON4	2021-09-26	14.3	7.2
WW21-3400	NL11	2021-09-29	1	1
WW21-3404	NL10	2021-09-29	3	1
WW21-3408	NT5	2021-09-21	34.4	73.7
WW21-3409	NT6	2021-09-21	7.7	9.1
WW21-3410	NT5	2021-09-22	33.1	81.1
WW21-3411	NT6	2021-09-22	4.1	7.2
WW21-3412	NT5	2021-09-23	70.1	144.3
WW21-3413	NT6	2021-09-23	3.7	3
WW21-3414	NT5	2021-09-24	55.7	109.7
WW21-3415	NT6	2021-09-24	6.5	1
WW21-3416	NT3	2021-09-20	58.6	67.9
WW21-3417	NT3	2021-09-23	12.9	8.5
WW21-3418	NT3	2021-09-27	14.3	21.5
WW21-3419	NT4	2021-09-20	3	3
WW21-3421	NU1	2021-09-22	3	1
WW21-3422	NU1	2021-09-24	3	3.4
WW21-3423	NU1	2021-09-27	7.4	10.1
WW21-3424	NU2	2021-09-27	1	1
WW21-3425	NU2	2021-09-28	1	1
WW21-3426	NU2	2021-09-29	1	1
WW21-3430	QC1	2021-09-29	8.1	4.9
WW21-3431	QC2	2021-09-29	6.8	3
WW21-3432	QC1	2021-10-02	18.6	4.5
WW21-3433	QC2	2021-10-02	7.9	8
WW21-3444	NL11	2021-10-04	3	1
WW21-3445	NU1	2021-09-29	3	1
WW21-3448	NU2	2021-10-04	1	1
WW21-3449	NU2	2021-10-05	1	1
WW21-3454	BC1	2021-09-30	21.4	8.3
WW21-3455	BC2	2021-09-30	46.9	37.1
WW21-3456	BC3	2021-09-30	6.1	3.7
WW21-3457	BC4	2021-09-30	12.2	3
WW21-3458	BC5	2021-09-30	9.9	3.7
WW21-3459	BC1	2021-10-03	19.5	1
WW21-3460	BC2	2021-10-03	10.2	3
WW21-3461	BC3	2021-10-03	68.6	40.5
WW21-3462	BC4	2021-10-03	5.6	1
WW21-3463	BC5	2021-10-03	7.3	3
WW21-3464	AB1	2021-09-30	117.9	83.1
WW21-3465	AB1	2021-10-03	32.8	20.8
WW21-3466	ON1	2021-09-28	13.2	7.1
WW21-3467	ON2	2021-09-28	15.3	4.5
WW21-3468	ON3	2021-09-28	12.2	5.9
WW21-3469	ON4	2021-09-28	7.8	7.7
WW21-3476	NS1	2021-09-27	3.9	1
WW21-3477	NS2	2021-09-27	5.3	1
WW21-3478	NS3	2021-09-27	1	1
WW21-3479	NS1	2021-09-29	7.3	1
WW21-3480	NS2	2021-09-29	7.2	3
WW21-3481	NS3	2021-09-29	3	1
WW21-3482	ON1	2021-10-03	8.8	3.4
WW21-3483	ON2	2021-10-03	5.7	3
WW21-3484	ON3	2021-10-03	13.8	10.8
WW21-3485	ON4	2021-10-03	5.2	3
WW21-3499	NL6	2021-10-04	1	1
WW21-3510	NL11	2021-10-07	7.4	4
WW21-3512	NL10	2021-10-07	1	1
WW21-3515	NU2	2021-10-06	1	1
WW21-3516	NU2	2021-10-07	1	1
WW21-3517	NU1	2021-10-01	3	1
WW21-3518	NU1	2021-10-04	1	1
WW21-3521	ON1	2021-10-05	5.9	3
WW21-3522	ON2	2021-10-05	11.1	3.8
WW21-3523	ON3	2021-10-05	8.6	4.3
WW21-3524	ON4	2021-10-05	6.1	3
WW21-3540	BC1	2021-10-07	26.8	21.2
WW21-3541	BC2	2021-10-07	15.9	8.1
WW21-3542	BC3	2021-10-07	70.6	52.5
WW21-3543	BC4	2021-10-07	11.3	4.4
WW21-3544	BC5	2021-10-07	33.5	20.8
WW21-3545	BC1	2021-10-10	22.3	11
WW21-3546	BC2	2021-10-10	23.2	12.5
WW21-3547	BC3	2021-10-10	11.9	8.4
WW21-3548	BC4	2021-10-10	34.4	15.6
WW21-3549	BC5	2021-10-10	14.6	12.8
WW21-3550	QC1	2021-10-06	15.4	13.6
WW21-3551	QC2	2021-10-06	8.8	5
WW21-3552	QC1	2021-10-09	14.5	8.6
WW21-3553	QC2	2021-10-09	6.4	3.1
WW21-3554	NL11	2021-10-12	1	1
WW21-3563	NS1	2021-10-04	7.4	4.5
WW21-3564	NS2	2021-10-04	9.8	13.6
WW21-3565	NS3	2021-10-04	3	1
WW21-3566	NS1	2021-10-06	9	39.8
WW21-3567	NS2	2021-10-06	13.8	23.1
WW21-3568	NS3	2021-10-06	4	3
WW21-3569	ON1	2021-10-10	3.6	3.3
WW21-3570	ON2	2021-10-10	4.3	3
WW21-3571	ON3	2021-10-10	5.3	3.3
WW21-3572	ON4	2021-10-10	7.9	5.5
WW21-3579	NU1	2021-10-08	3	5
WW21-3580	NU2	2021-10-12	1	1
WW21-3587	AB1	2021-10-07	51.5	37.4
WW21-3588	AB1	2021-10-10	24.2	17.3
WW21-3591	NU1	2021-10-11	1	1
WW21-3592	NU2	2021-10-13	1	1
WW21-3593	NU2	2021-10-14	1	1
WW21-3595	NL11	2021-10-14	1	1
WW21-3597	NL10	2021-10-13	1	1
WW21-3602	NL6	2021-10-13	1	1
WW21-3613	ON1	2021-10-12	8.1	7.6
WW21-3614	ON2	2021-10-12	4.2	1
WW21-3615	ON3	2021-10-12	7.9	8.3
WW21-3616	ON4	2021-10-12	9.4	6.2
WW21-3617	NU1	2021-10-06	1	1
WW21-3620	QC1	2021-10-13	15.6	3
WW21-3621	QC2	2021-10-13	7.7	3
WW21-3622	QC1	2021-10-16	21.2	10.4
WW21-3623	QC2	2021-10-16	20.5	16.8
WW21-3639	NU1	2021-10-13	3	1
WW21-3640	NU1	2021-10-15	3.5	1
WW21-3645	BC1	2021-10-14	27	23.7
WW21-3646	BC2	2021-10-14	15	12
WW21-3647	BC3	2021-10-14	15.4	9.8
WW21-3648	BC4	2021-10-14	14.3	9.7
WW21-3649	BC5	2021-10-14	7.7	1
WW21-3650	BC1	2021-10-17	21.9	18.3
WW21-3651	BC2	2021-10-17	5.2	1
WW21-3652	BC3	2021-10-17	29.5	22.5
WW21-3653	BC4	2021-10-17	10.9	4.7
WW21-3654	BC5	2021-10-17	10.5	4.7
WW21-3655	AB1	2021-10-14	44.6	24.3
WW21-3656	AB1	2021-10-17	84	56.3
WW21-3657	NL11	2021-10-18	3	1
WW21-3663	ON1	2021-10-17	10.5	4.4
WW21-3664	ON2	2021-10-17	8.5	9.9
WW21-3665	ON3	2021-10-17	8	8.2
WW21-3666	ON4	2021-10-17	14.3	7.5
WW21-3679	NS1	2021-10-11	5.6	3.5
WW21-3680	NS2	2021-10-11	6.8	5.3
WW21-3681	NS3	2021-10-11	7.2	1
WW21-3682	NS1	2021-10-13	8.3	3.7
WW21-3683	NS3	2021-10-13	132.1	66.3
WW21-3684	NS3	2021-10-18	9.9	4.6
WW21-3685	NU2	2021-10-18	1	1
WW21-3686	NU2	2021-10-20	1	1
WW21-3688	ON1	2021-10-19	7.3	8
WW21-3689	ON2	2021-10-19	10.1	7.5
WW21-3690	ON3	2021-10-19	9.1	8.9
WW21-3691	ON4	2021-10-19	6.6	5.3
WW21-3693	NL11	2021-10-21	1	1
WW21-3696	NL10	2021-10-21	1	1
WW21-3701	NL6	2021-10-20	1	1
WW21-3736	BC1	2021-10-21	26.5	31.6
WW21-3737	BC2	2021-10-21	6.1	16.6
WW21-3738	BC3	2021-10-21	29.7	37.5
WW21-3739	BC4	2021-10-21	7.6	6.3
WW21-3740	BC5	2021-10-21	36	41.2
WW21-3741	BC1	2021-10-24	16.3	11.2
WW21-3742	BC2	2021-10-24	12.5	6.9
WW21-3743	BC3	2021-10-24	9	3
WW21-3744	BC4	2021-10-24	10.3	14.9
WW21-3745	BC5	2021-10-24	40.4	47.1
WW21-3746	AB1	2021-10-21	38.4	48.6
WW21-3747	AB1	2021-10-24	28.9	49
WW21-3748	NS2	2021-10-13	11	9.7
WW21-3749	NS1	2021-10-18	19.3	43.9
WW21-3750	NS2	2021-10-18	7	4.7
WW21-3751	NS1	2021-10-20	9.2	9.9
WW21-3752	NS2	2021-10-20	7	6.4
WW21-3753	NS3	2021-10-20	7.2	1
WW21-3763	ON1	2021-10-24	4.9	3
WW21-3764	ON2	2021-10-24	5.8	7.4
WW21-3765	ON3	2021-10-24	4.9	3
WW21-3766	ON4	2021-10-24	4.7	3.4
WW21-3773	NL11	2021-10-25	3	1
WW21-3775	NU1	2021-10-21	4	1
WW21-3776	NU1	2021-10-22	1	1
WW21-3777	NU2	2021-10-25	1	1
WW21-3778	NU2	2021-10-27	1	1
WW21-3781	NU1	2021-10-18	3	1
WW21-3783	NL6	2021-10-25	3	1
WW21-3788	ON1	2021-10-26	4.7	3
WW21-3789	ON2	2021-10-26	8.7	6.8
WW21-3790	ON3	2021-10-26	5.6	1
WW21-3791	ON4	2021-10-26	3	1
WW21-3793	NL11	2021-10-28	1	1
WW21-3798	NL10	2021-10-27	1	1
WW21-3805	QC1	2021-10-27	6.8	39.6
WW21-3806	QC2	2021-10-27	7.6	7.3
WW21-3807	QC1	2021-10-30	7.5	16.5
WW21-3808	QC2	2021-10-30	8.3	13.1
WW21-3819	NL11	2021-11-01	3	1
WW21-3824	NT3	2021-10-07	9.8	7.6
WW21-3825	NT3	2021-10-12	21	23.8
WW21-3826	NT3	2021-10-14	11.9	28.1
WW21-3827	NT3	2021-10-21	62	86.7
WW21-3828	NT3	2021-10-25	32.8	24.1
WW21-3839	BC1	2021-10-28	27.5	29.6
WW21-3840	BC2	2021-10-28	7.6	6.3
WW21-3841	BC3	2021-10-28	20.1	24
WW21-3842	BC4	2021-10-28	5.1	3.6
WW21-3843	BC5	2021-10-28	82.1	92.3
WW21-3844	BC1	2021-10-31	24.2	28.6
WW21-3845	BC2	2021-10-31	14.7	9.4
WW21-3846	BC3	2021-10-31	8.1	4.6
WW21-3847	BC4	2021-10-31	9.3	11.3
WW21-3848	BC5	2021-10-31	28.4	31.3
WW21-3849	NS1	2021-10-25	3	3.2
WW21-3850	NS2	2021-10-25	9.3	11.1
WW21-3851	NS3	2021-10-25	3	4.9
WW21-3852	NS1	2021-10-27	8.2	7.5
WW21-3853	NS2	2021-10-27	6.5	3.3
WW21-3854	NS3	2021-10-27	7.4	1
WW21-3861	NU1	2021-10-25	1	1
WW21-3862	NU1	2021-10-27	1	1
WW21-3867	ON1	2021-10-31	5.2	12.7
WW21-3868	ON2	2021-10-31	6.4	5.7
WW21-3869	ON3	2021-10-31	8.7	3.5
WW21-3870	ON4	2021-10-31	7	1
WW21-3883	NU2	2021-11-01	1	1
WW21-3884	NU2	2021-11-03	1	1
WW21-3887	NL11	2021-11-04	3	1
WW21-3889	NL10	2021-11-03	1	1
WW21-3896	NL6	2021-11-01	1	1
WW21-3898	NU1	2021-11-01	3	1
WW21-3904	ON1	2021-11-02	34.1	29.5
WW21-3905	ON2	2021-11-02	8.2	1
WW21-3906	ON3	2021-11-02	7.1	4
WW21-3907	ON4	2021-11-02	3	1
WW21-3912	NU1	2021-10-29	1	1
WW21-3921	NT3	2021-10-28	21.9	22.3
WW21-3922	NT3	2021-11-02	31.8	24.4
WW21-3927	AB1	2021-10-28	24.6	19.2
WW21-3928	AB1	2021-10-31	36.1	27.5
WW21-3929	AB1	2021-11-04	38	26.3
WW21-3930	AB1	2021-11-07	20.8	23
WW21-3931	QC1	2021-11-03	7.5	11.8
WW21-3932	QC2	2021-11-03	9.8	12
WW21-3933	QC1	2021-11-06	11.4	14.3
WW21-3948	NU1	2021-11-03	1	1
WW21-3949	NU1	2021-11-05	1	1
WW21-3954	BC1	2021-11-04	11.3	9.7
WW21-3955	BC2	2021-11-04	3	1
WW21-3956	BC3	2021-11-04	3.9	1
WW21-3957	BC4	2021-11-04	6.6	3
WW21-3958	BC5	2021-11-04	8.6	7.1
WW21-3959	BC1	2021-11-07	7.6	14
WW21-3960	BC2	2021-11-07	3	1
WW21-3961	BC3	2021-11-07	6.8	4.9
WW21-3962	BC4	2021-11-07	8.6	4.7
WW21-3963	BC5	2021-11-07	10	5
WW21-3964	NS1	2021-11-01	3	1
WW21-3965	NS2	2021-11-01	4	1
WW21-3966	NS3	2021-11-01	33.5	1
WW21-3967	NS1	2021-11-03	3.9	3.2
WW21-3968	NS2	2021-11-03	8.4	12.6
WW21-3969	NS3	2021-11-03	10.4	1
WW21-3970	NL11	2021-11-08	3	1
WW21-3985	ON1	2021-11-07	7.1	9.6
WW21-3986	ON2	2021-11-07	5.3	3
WW21-3987	ON3	2021-11-07	4.8	3
WW21-3988	ON4	2021-11-07	3	3
WW21-3996	NL11	2021-11-10	3	1
WW21-4001	NL10	2021-11-10	1	1
WW21-4006	NU1	2021-11-08	1	1
WW21-4007	NU2	2021-11-08	1	1
WW21-4008	NU2	2021-11-10	1	1
WW21-4013	NL6	2021-11-08	1	1
WW21-4047	QC1	2021-11-10	6.1	15.6
WW21-4048	QC2	2021-11-10	8.6	10.7
WW21-4049	QC1	2021-11-13	9.1	9.4
WW21-4050	QC2	2021-11-13	7.8	8.9
WW21-4055	BC1	2021-11-11	8.6	7.9
WW21-4056	BC2	2021-11-11	4	3.1
WW21-4057	BC3	2021-11-11	6.7	3.6
WW21-4058	BC5	2021-11-11	10	6
WW21-4059	BC1	2021-11-14	5.6	1
WW21-4060	BC2	2021-11-14	3	1
WW21-4061	BC3	2021-11-14	6	1
WW21-4062	BC4	2021-11-14	3	1
WW21-4063	BC5	2021-11-14	7.7	3
WW21-4064	AB1	2021-11-11	20.8	23.9
WW21-4065	AB1	2021-11-14	31.3	25.7
WW21-4066	ON1	2021-11-09	9.3	11.4
WW21-4067	ON2	2021-11-09	16.4	16.4
WW21-4068	ON3	2021-11-09	34.7	28.9
WW21-4069	ON4	2021-11-09	8.1	1
WW21-4076	NU1	2021-11-10	1	1
WW21-4077	NU1	2021-11-12	3	1
WW21-4084	NT3	2021-11-08	3.9	3
WW21-4087	NT4	2021-11-01	3	1
WW21-4088	NT5	2021-11-04	6.6	4.3
WW21-4089	NT6	2021-11-04	6.5	1
WW21-4090	NT5	2021-11-08	8	3
WW21-4091	NT6	2021-11-08	6.7	1
WW21-4092	NT5	2021-11-09	4	3.8
WW21-4093	NT6	2021-11-09	2.8	1
WW21-4094	NT5	2021-11-10	4.7	3
WW21-4095	NT6	2021-11-10	3	1
WW21-4096	NT5	2021-11-12	3	1
WW21-4097	NT6	2021-11-12	1	1
WW21-4104	NS1	2021-11-08	3	3
WW21-4105	NS2	2021-11-08	3.6	3
WW21-4106	NS3	2021-11-08	3	1
WW21-4107	NS1	2021-11-10	4.8	3.3
WW21-4108	NS2	2021-11-10	11	1
WW21-4109	NS3	2021-11-10	6.3	3
WW21-4110	ON1	2021-11-14	5.7	7.3
WW21-4111	ON2	2021-11-14	8.2	3
WW21-4112	ON3	2021-11-14	4.2	5.1
WW21-4113	ON4	2021-11-14	4.3	4.1
WW21-4120	NU2	2021-11-15	1	1
WW21-4121	NU2	2021-11-17	1	1
WW21-4122	NL11	2021-11-15	2.8	1
WW21-4126	NL6	2021-11-15	3	1
WW21-4132	ON1	2021-11-16	3.8	3.4
WW21-4133	ON2	2021-11-16	18.5	6.4
WW21-4134	ON3	2021-11-16	5.3	5.1
WW21-4135	ON4	2021-11-16	2.9	4
WW21-4136	NL11	2021-11-18	1	1
WW21-4140	NL10	2021-11-17	1	1
WW21-4148	QC1	2021-11-17	8.1	7.8
WW21-4149	QC2	2021-11-17	9	3.6
WW21-4150	QC1	2021-11-20	8.8	4.8
WW21-4151	QC2	2021-11-20	5.7	3.3
WW21-4166	NT5	2021-11-16	3	5.9
WW21-4167	NT6	2021-11-16	4.1	1
WW21-4179	AB1	2021-11-18	20.8	21.8
WW21-4180	AB1	2021-11-21	24.9	17.9
WW21-4187	NL11	2021-11-22	3	1
WW21-4190	NU1	2021-11-15	1	70.3
WW21-4191	NU1	2021-11-17	1	1
WW21-4197	BC1	2021-11-18	10.9	4.5
WW21-4198	BC2	2021-11-18	4.2	3
WW21-4199	BC3	2021-11-18	4.6	3
WW21-4200	BC4	2021-11-18	23.8	42.6
WW21-4201	BC5	2021-11-18	11.2	8.7
WW21-4202	BC1	2021-11-21	7.8	9.8
WW21-4203	BC2	2021-11-21	4.4	12.2
WW21-4204	BC3	2021-11-21	6.5	3
WW21-4205	BC4	2021-11-21	8.5	4.8
WW21-4206	BC5	2021-11-21	8.3	4.3
WW21-4207	NS1	2021-11-15	3	1
WW21-4208	NS2	2021-11-15	9.7	9
WW21-4209	NS3	2021-11-15	3	1
WW21-4210	NS1	2021-11-17	1	1
WW21-4211	NS2	2021-11-17	3	1
WW21-4212	NS3	2021-11-17	9.3	1
WW21-4213	ON1	2021-11-21	6.9	3
WW21-4214	ON2	2021-11-21	8.4	3.3
WW21-4215	ON3	2021-11-21	9.9	7.3
WW21-4216	ON4	2021-11-21	6.7	3
WW21-4224	NL6	2021-11-22	3007.6	194.7
WW21-4229	NU2	2021-11-22	1	1
WW21-4230	NU2	2021-11-24	1	1
WW21-4233	NU1	2021-11-19	1	1
WW21-4234	ON1	2021-11-23	6.1	3
WW21-4235	ON2	2021-11-23	14.4	12.9
WW21-4236	ON3	2021-11-23	13.5	15.9
WW21-4237	ON4	2021-11-23	7.6	11.7
WW21-4242	NU1	2021-11-22	3	1
WW21-4256	NL11	2021-11-25	9.8	3
WW21-4261	NL10	2021-11-24	1	1
WW21-4272	BC1	2021-11-25	10	3
WW21-4273	BC2	2021-11-25	3	1
WW21-4274	BC3	2021-11-25	7.2	3
WW21-4275	BC4	2021-11-25	7.1	3.7
WW21-4276	BC5	2021-11-25	6.8	1
WW21-4277	BC1	2021-11-28	3	1
WW21-4278	BC2	2021-11-28	3	1
WW21-4279	BC3	2021-11-28	3	1
WW21-4280	BC4	2021-11-28	6.2	4.3
WW21-4281	BC5	2021-11-28	4.9	5.4
WW21-4282	AB1	2021-11-25	14.3	5.9
WW21-4283	AB1	2021-11-28	19.8	7.7
WW21-4290	NL11	2021-11-29	3	1
WW21-4299	QC1	2021-11-24	9.8	7.2
WW21-4300	QC2	2021-11-24	8.1	3
WW21-4301	QC1	2021-11-27	9.9	3
WW21-4302	QC2	2021-11-27	6.6	3
WW21-4303	ON1	2021-11-28	10.7	1
WW21-4304	ON2	2021-11-28	14.2	4
WW21-4305	ON3	2021-11-28	89.8	60.6
WW21-4306	ON4	2021-11-28	7.1	3
WW21-4313	NS1	2021-11-22	22.8	1
WW21-4314	NS2	2021-11-22	12.6	1
WW21-4315	NS3	2021-11-22	5.3	1
WW21-4316	NS1	2021-11-24	5.7	1
WW21-4317	NS2	2021-11-24	12.4	1
WW21-4318	NS3	2021-11-24	14.2	1
WW21-4325	NL6	2021-11-29	1366.2	85.2
WW21-4338	NU1	2021-11-24	1	1
WW21-4339	NU1	2021-11-26	1	1
WW21-4340	NU1	2021-11-29	1	1
WW21-4342	NU2	2021-11-29	1	1
WW21-4350	ON1	2021-11-30	7.2	3
WW21-4351	ON3	2021-11-30	12.8	7.4
WW21-4352	ON4	2021-11-30	6.2	1
WW21-4364	QC1	2021-12-01	20.8	8.4
WW21-4365	QC2	2021-12-01	25.3	14.6
WW21-4402	NS1	2021-11-29	5.1	1
WW21-4403	NS2	2021-11-29	6.4	1
WW21-4404	NS3	2021-11-29	6.1	1
WW21-4405	NS1	2021-12-01	5.6	1
WW21-4406	NS2	2021-12-01	3	1
WW21-4407	NS3	2021-12-01	3	1
WW21-4639	NT5	2021-11-22	3	3
WW21-4640	NT5	2021-11-23	3	1

The more sparsely populated regions investigated in this study showed less consistent detection of D377Y, with detection in 50% of remote sites in Newfoundland and Labrador (n=6/12) during at least one time point throughout the sampling period. In Newfoundland and Labrador, D377Y was not detected in 4/6 sites prior to the last week of October 2021, whereas the remaining two sites had detection in July and September.

In the northern Territorial regions, Delta signal was detected in all six Northwest Territories (NWT) sites and both Nunavut (NU) sites during at least one time point. The NU1 variant had sporadic low-level detection in September, while D377Y was detected in NU2 in August to mid-September, peaking with a strong signal on September 8. The NT1 variant was sampled only in November, with high levels of detection throughout the month. Delta signal was first detected between August 12–19 in four of the remaining five NWT sites, and on September 20 for the final site. Four NWT sites (NT1,NT4–NT6) were not sampled during the month of October.

Discussion

This study describes the development of RT-qPCR assays to detect the N gene D377Y mutation associated with the SARS-CoV-2 Delta variant. The LODs of this assay were near the theoretical limit of RT-qPCR and sufficient for sensitive detection in wastewater, where SARS-CoV-2 RNA concentrations can be very low. The robustness and sensitivity of the V component of the assay allows for trending analysis, and where appropriate, early warning detection in communities and for monitoring the decline of the Delta wave.

The D377Y V assay is valuable for tracking the spread of the Delta variant in wastewater as it was used to monitor the spread of the Delta variant in eight major cities and 26 towns and rural locations across Canada over a four-month period. The Delta variant was detected in wastewater from all major Canadian cities, with a rapid increase in signal shortly following onset of detection, indicating rapid spread of Delta and displacement of other variants. Delta signal was also observed in approximately half of rural locations in Southern Canada, and all locations in Northern Canada. These data demonstrate the utility of this assay for tracking the spread of the SARS-CoV-2 Delta variant. These one-step RT-qPCR assays can be easily integrated into currently used wastewater surveillance programs to aid in SARS-CoV-2 surveillance.

Limitations

Assay limitations include the loss in sensitivity in the presence of the V allele, which limits the interpretation of the WT component of the assay during the onset of a Delta wave, where high levels of variant genomic material will attenuate the WT signal. This is consistent with previous studies that found a similar level of cross-reactivity between variant and WT assays ^{Footnote 13 Footnote 22}. In wastewater samples, this delayed cross-reactivity is negligible, as the SARS-CoV-2 concentration is very low. Other limitations of this assay include: 1) inconsistent detection when RNA concentration in samples approaches the LOD of the assay or 2) the presence of inhibitors found in wastewater. Limitations of wastewater-based surveillance include testing being limited to populations present within the wastewater catchment area, variations in viral shedding between SARS-CoV-2 variants and infected individuals, and variations in wastewater composition due to weather or industrial events.

The Delta variant of SARS-CoV-2 is defined by 27 mutations, which are commonly detected by whole genome sequencing ^{Footnote 3 Footnote 23 Footnote 24 Footnote 25}. While detection of one mutation such as D377Y is not determinative of Delta variant presence, it is highly indicative as the N gene D377Y mutation is found very rarely in non-Delta strains ^{Footnote 26}.

Conclusion

Surveillance using RT-qPCR is a rapid and cost-effective method of screening for SARS-CoV-2 variants in both wastewater and clinical specimens. These assays provide a complement to SARS-CoV-2 variant detection assays as previously described ^{Footnote 14} for surveillance of SARS-CoV-2 variants in wastewater. Wastewater-based surveillance is a valuable tool for tracking the spread of SARS-CoV-2 variants on a population level in regions where clinical testing is limited. The relative fraction of the Delta variant measured in wastewater using the assay developed in this work was communicated to public health decision-makers by weekly reporting across a network of surveillance sites throughout Canada. To our knowledge, these data were used as a complimentary public health intelligence stream and not directly actioned. Thus, over the course of the pandemic, this was principally the use for wastewater surveillance data amongst infectious control and public health leadership; likely because of a gap in trust arising from a lack of precedent and unfamiliarity with the data, in addition to the public scrutiny and pressure associated with pandemic. We hope that this work and the work of others will establish a base of use cases that will improve the action-ability of wastewater surveillance. A conservative use case could be to maintain wide-scale infectious control measures based on wastewater surveillance data. While more than a year has passed since the Delta wave, the relevance of the assay described here remains as sub-lineages of the Delta VOC has been observed in wild populations of white-tailed deer ^{Footnote 27 Footnote 28} and this work could contribute to the monitoring of the expanding host range of this virus. With the high number of asymptomatic COVID-19 cases and limited testing capacity worldwide, augmentation of surveillance capabilities by monitoring spread of SARS-CoV-2 variants in wastewater can aid in public health efforts.

Authors' statement

SWP — Conceptualization, methodology, investigation, validation, writing, visualization

JD — Methodology, investigation, validation

CD — Methodology, investigation, validation

AN — Conceptualization, resources, project administration

MRM — Conceptualization, supervision, project administration

CSM — Conceptualization, writing, supervision, funding acquisition, project administration

Competing interests

None.

Acknowledgments

We would like to thank Stacie Langner, Umar Mohammed, Graham Cox, Quinn Wonitowy, Nestor Medina, Nataliya Zharska, Ravinder Lidder, and Dave Spreitzer for their technical assistance and support. Chrystal Landgraff and Gary von Domselaar for providing genomic information on circulating SARS-CoV-2 in Canada. Cadham Provincial Laboratory virus detection staff and the communities and municipalities for providing wastewater samples for analysis.

Funding

This work was supported by internal funds from the Public Health Agency of Canada.

Appendix

Table A1: Positive control gBlock sequences for the SARS-CoV-2 Delta variant real-time quantitative reverse
transcription polymerase chain reaction assays

Region	Allele	Sequence
N D377Y	WT	AAAGATCCAAATTTCAAAGATCAAGTCATTTTGCTGAATAAGCATATTGACGCATACAAAACATTCCCACCAACAGA GCCTAAAAAGGACAAAAAGAAGAAGGCTGATGAAACTCAAGCCTTACCGCAGAGACAGAAGAAACAGCAAACTGTGAC TCTTCTTCCTGCTGCAGATTTGGATGATTTCTCCAAACAATTGCAA
	Variant	AAAGATCCAAATTTCAAAGATCAAGTCATTTTGCTGAATAAGCATATTGACGCATACAAAACATTCCCACCAACAGA GCCTAAAAAGGACAAAAAGAAGAAGGCTTATGAAACTCAAGCCTTACCGCAGAGACAGAAGAAACAGCAAACTGT GACTCTTCTTCCTGCTGCAGATTTGGATGATTTCTCCAAACAATTGCAA
Table A1 abbreviations Abbreviations: SARS-CoV-2, severe acute respiratory syndrome coronavirus 2; WT, wild-type

Table A2: Location and number of samples tested from wastewater treatment plants and lift stations across Canada

Site code	Region	Sampling date range	Date of first detection	Date of peak signal	Number of samples
AB1	Edmonton, AB	2021-07-08 to 2021-11-28	2021-07-18	2021-09-05	40
BC1	Vancouver, BC	2021-07-15 to 2021-11-28	2021-07-22	2021-09-12	37
BC2	Vancouver, BC	2021-07-15 to 2021-11-28	2021-07-22	2021-09-12	37
BC3	Vancouver, BC	2021-07-15 to 2021-11-28	2021-07-22	2021-09-12	38
BC4	Vancouver, BC	2021-07-15 to 2021-11-28	2021-07-22	2021-07-22	37
BC5	Vancouver, BC	2021-07-15 to 2021-11-28	2021-07-22	2021-09-05	38
NL1	Newfoundland and Labrador	2021-10-04 to 2021-11-29	Not detected	Not detected	9
NL2	Newfoundland and Labrador	2021-10-04 to 2021-11-29	2021-11-29	2021-11-29	9
NL3	Newfoundland and Labrador	2021-10-04 to 2021-11-29	2021-11-16	2021-11-16	8
NL4	Newfoundland and Labrador	2021-07-19 to 2021-11-24	Not detected	Not detected	14
NL5	Newfoundland and Labrador	2021-10-06 to 2021-11-17	Not detected	Not detected	6
NL6	Newfoundland and Labrador	2021-10-04 to 2021-11-29	2021-11-22	2021-11-22	9
NL7	Newfoundland and Labrador	2021-07-14 to 2021-11-24	2021-07-21	2021-07-21	20
NL8	Newfoundland and Labrador	2021-09-16 to 2021-11-29	Not detected	Not detected	8
NL9	Newfoundland and Labrador	2021-10-14 to 2021-11-30	Not detected	Not detected	7
NL10	Newfoundland and Labrador	2021-07-22 to 2021-11-24	2021-08-30	2021-08-30	20
NL11	Newfoundland and Labrador	2021-07-13 to 2021-11-29	2021-09-02	2021-10-07	39
NL12	Newfoundland and Labrador	2021-10-04 to 2021-11-30	2021-10-25	2021-10-25	9
NL13	Newfoundland and Labrador	2021-10-14 to 2021-11-30	Not detected	Not detected	7
NS1	Halifax, Nova Scotia	2021-07-05 to 2021-12-01	2021-08-23	2021-10-18	42
NS2	Halifax, Nova Scotia	2021-07-05 to 2021-12-01	2021-08-04	2021-09-06	42
NS3	Halifax, Nova Scotia	2021-07-05 to 2021-12-01	2021-08-30	2021-10-13	42
NT1	Northwest Territories	2021-11-03 to 2021-11-24	2021-11-04	2021-11-10	15
NT2	Northwest Territories	2021-10-19 to 2021-11-17	2021-09-20	2021-09-20	11
NT3	Northwest Territories	2021-08-16 to 2021-11-08	2021-08-16	2021-09-20	16
NT4	Northwest Territories	2021-08-16 to 2021-11-01	2021-08-19	2021-08-30	12
NT5	Northwest Territories	2021-06-30 to 2021-11-23	2021-08-12	2021-09-23	53
NT6	Northwest Territories	2021-08-19 to 2021-11-16	2021-08-19	2021-08-26	23
NU1	Nunavut	2021-07-14 to 2021-11-29	2021-09-10	2021-11-15	54
NU2	Nunavut	2021-07-22 to 2021-11-29	2021-08-17	2021-09-08	56
ON1	Toronto, ON	2021-07-11 to 2021-11-30	2021-07-11	2021-08-29	38
ON2	Toronto, ON	2021-07-11 to 2021-11-28	2021-07-18	2021-07-27	37
ON3	Toronto, ON	2021-07-11 to 2021-11-30	2021-07-18	2021-08-15	37
ON4	Toronto, ON	2021-07-11 to 2021-11-30	2021-08-03	2021-09-14	38
QC1	Montréal, QC	2021-07-14 to 2021-12-01	2021-07-21	2021-09-08	36
QC2	Montréal, QC	2021-07-17 to 2021-12-01	2021-08-11	2021-10-16	36
Tableau A2 abbreviations Abbreviations: AB, Alberta; BC, British Columbia; NL, Newfoundland and Labrador; NS, Nova Scotia; NT, Northwest Territories; NU, Nunavut; ON, Ontario; QC, Québec